Incidental Mutation 'R2146:Cps1'
ID233794
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2146 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 67152379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably benign
Transcript: ENSMUST00000027144
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 intron probably null
R6034:Cps1 UTSW 1 67157713 intron probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7278:Cps1 UTSW 1 67170921 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R7936:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGAATTTACTGTCCAGGCCTG -3'
(R):5'- CTGAGCATTCACCAAATGGCC -3'

Sequencing Primer
(F):5'- CCAGGCCTGGTGCTTATTGC -3'
(R):5'- TGGCCTTAAGAAAACCCTGTTC -3'
Posted On2014-10-01