Mutagenetix > Incidental Mutation

Incidental Mutation 'R2146:Cps1'

233794

Institutional Source

Beutler Lab

Gene Symbol

Cps1

Ensembl Gene

ENSMUSG00000025991

Gene Name

carbamoyl-phosphate synthetase 1

Synonyms

CPSase I, D1Ucla3, CPS, 4732433M03Rik

MMRRC Submission

040149-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67123026-67231259 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 67152379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027144]

AlphaFold

Q8C196

Predicted Effect

probably benign
Transcript: ENSMUST00000027144

SMART Domains

Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991

Domain	Start	End	E-Value	Type
CPSase_sm_chain	44	184	2.5e-70	SMART
Pfam:GATase	221	397	1.5e-40	PFAM
low complexity region	426	436	N/A	INTRINSIC
Pfam:ATP-grasp_4	543	724	6.8e-12	PFAM
Pfam:CPSase_L_D2	546	750	1.7e-85	PFAM
Pfam:ATP-grasp	554	722	4.9e-8	PFAM
Pfam:Dala_Dala_lig_C	561	718	1.5e-7	PFAM
CPSase_L_D3	839	962	1.18e-57	SMART
Pfam:ATP-grasp_4	1085	1264	1e-19	PFAM
Pfam:CPSase_L_D2	1088	1291	7.4e-32	PFAM
Pfam:Dala_Dala_lig_C	1095	1279	1.6e-6	PFAM
Pfam:ATP-grasp	1096	1263	2.8e-12	PFAM
MGS	1373	1465	1.53e-15	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,347,844		probably null	Het
4933406M09Rik	T	A	1: 134,390,513	M341K	probably damaging	Het
9530002B09Rik	T	A	4: 122,689,405	C13*	probably null	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Adamts18	G	C	8: 113,845,003	A116G	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap6	A	G	X: 168,796,500	T94A	probably benign	Het
Arhgef5	T	C	6: 43,283,318	S1413P	probably damaging	Het
Atg4c	C	A	4: 99,221,226	N143K	possibly damaging	Het
BC005561	T	C	5: 104,518,991	F460L	probably benign	Het
C1qtnf12	A	G	4: 155,966,465	N297S	probably benign	Het
Cadps2	G	T	6: 23,838,999		probably benign	Het
Ccdc185	G	T	1: 182,747,520	H535N	possibly damaging	Het
Ccdc57	A	G	11: 120,885,225		probably benign	Het
Cd163	A	G	6: 124,309,208	H239R	probably damaging	Het
Ceacam2	G	T	7: 25,527,943	C166*	probably null	Het
Ces5a	T	A	8: 93,534,699	E33D	probably benign	Het
Chl1	T	C	6: 103,715,401		probably null	Het
Chsy3	G	A	18: 59,176,472	V266I	probably benign	Het
Cpa5	G	T	6: 30,626,822	R251L	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cstf1	T	C	2: 172,375,763	Y99H	probably damaging	Het
Cyp2j11	G	A	4: 96,316,358	T317I	probably damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dennd3	C	T	15: 73,523,496	T146M	probably damaging	Het
Dnah2	T	C	11: 69,515,761	M552V	probably benign	Het
Dnajc22	T	C	15: 99,104,383	V303A	probably benign	Het
Dtx2	T	G	5: 136,030,610	L458R	probably benign	Het
Elmsan1	G	T	12: 84,173,035	P382T	probably damaging	Het
Fat3	A	T	9: 15,990,512	F3072L	probably benign	Het
Fgf5	T	C	5: 98,275,550	*265R	probably null	Het
Fndc11	A	G	2: 181,222,125	E241G	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gm4922	T	G	10: 18,783,516	Q486P	probably benign	Het
Gm5786	A	T	12: 59,081,298		noncoding transcript	Het
Hepacam2	A	T	6: 3,463,378		probably benign	Het
Ints9	G	A	14: 64,986,343	G89R	possibly damaging	Het
Iqcm	T	A	8: 75,888,613	W441R	probably damaging	Het
Itga10	T	C	3: 96,651,492	L382P	possibly damaging	Het
Itga10	G	T	3: 96,653,723	G635W	probably damaging	Het
Kbtbd2	A	G	6: 56,779,090	Y554H	probably damaging	Het
Kif1b	T	C	4: 149,184,309	K1649R	probably damaging	Het
L1cam	A	T	X: 73,861,141	F536Y	probably damaging	Het
Magee1	A	T	X: 105,122,958	D783V	probably damaging	Het
Marveld3	A	T	8: 109,959,802	V144E	probably benign	Het
Mcam	T	C	9: 44,136,635	V59A	probably damaging	Het
Mdga2	C	T	12: 66,868,741	E47K	probably damaging	Het
Metrn	T	A	17: 25,796,627	E38V	probably damaging	Het
Mfrp	T	C	9: 44,103,718	L314P	probably benign	Het
Mospd2	A	G	X: 164,956,477		probably null	Het
Mycbp2	G	A	14: 103,155,922	H3068Y	probably damaging	Het
Myh6	C	T	14: 54,953,771	R871H	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1104	T	A	2: 87,021,665	N293I	probably damaging	Het
Olfr1465	T	C	19: 13,314,121	T55A	probably benign	Het
Olfr156	A	G	4: 43,821,178	F61S	probably damaging	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pdcd11	A	G	19: 47,104,752	M490V	probably benign	Het
Pet2	T	C	X: 89,406,277	D82G	possibly damaging	Het
Pkd2	A	C	5: 104,455,590		probably benign	Het
Reps1	T	A	10: 18,093,313	D206E	probably benign	Het
Rimkla	T	A	4: 119,474,582	M140L	possibly damaging	Het
Rnf13	T	G	3: 57,802,486	I150S	probably null	Het
Rxfp4	C	T	3: 88,652,893	A84T	probably damaging	Het
Serpinb8	T	A	1: 107,605,927	D237E	probably benign	Het
Sgo2b	T	G	8: 63,928,023	T592P	probably benign	Het
Slc35d1	A	T	4: 103,205,152	I228N	probably damaging	Het
Slc39a1	T	G	3: 90,249,450	H104Q	probably benign	Het
Slc6a6	T	C	6: 91,735,180	V230A	probably benign	Het
Slc9a3	A	G	13: 74,121,603	E30G	probably benign	Het
Slc9c1	A	G	16: 45,593,464	Y985C	probably benign	Het
Supt6	A	G	11: 78,230,932	F298S	probably damaging	Het
Tada2a	T	C	11: 84,079,629	D432G	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tnpo3	A	G	6: 29,589,036	V105A	probably benign	Het
Ttc7	T	C	17: 87,346,707		probably benign	Het
Ttn	T	C	2: 76,897,188		probably benign	Het
Usp16	T	C	16: 87,473,187		probably null	Het
Usp36	A	G	11: 118,268,665	L486S	probably benign	Het
Uty	T	C	Y: 1,239,816	I72V	probably benign	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Zfp160	A	G	17: 21,026,982	K598R	probably benign	Het
Zfp39	T	C	11: 58,890,332	N535D	probably benign	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Cps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Cps1	APN	1	67152380	splice site	probably benign
IGL00897:Cps1	APN	1	67215564	missense	probably benign	0.08
IGL00928:Cps1	APN	1	67123234	missense	probably benign
IGL01063:Cps1	APN	1	67195166	missense	possibly damaging	0.91
IGL01081:Cps1	APN	1	67206824	missense	probably damaging	1.00
IGL01361:Cps1	APN	1	67195145	missense	probably benign	0.03
IGL01396:Cps1	APN	1	67157786	missense	probably damaging	1.00
IGL01516:Cps1	APN	1	67230284	missense	probably damaging	0.99
IGL01695:Cps1	APN	1	67197035	missense	probably benign
IGL02022:Cps1	APN	1	67172872	splice site	probably benign
IGL02032:Cps1	APN	1	67230315	missense	probably benign	0.03
IGL02049:Cps1	APN	1	67143954	missense	possibly damaging	0.68
IGL02197:Cps1	APN	1	67157764	missense	probably benign
IGL02217:Cps1	APN	1	67174382	missense	probably benign	0.06
IGL02555:Cps1	APN	1	67214021	missense	probably benign	0.06
IGL02570:Cps1	APN	1	67148703	splice site	probably benign
IGL02633:Cps1	APN	1	67123237	missense	probably benign
IGL02711:Cps1	APN	1	67212517	splice site	probably benign
IGL02737:Cps1	APN	1	67148774	missense	probably benign	0.35
IGL03030:Cps1	APN	1	67142921	missense	probably damaging	1.00
IGL03255:Cps1	APN	1	67145801	nonsense	probably null
Madman	UTSW	1	67160871	missense	probably damaging	0.96
maniac	UTSW	1	67157878	critical splice donor site	probably null
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0140:Cps1	UTSW	1	67180116	missense	probably benign
R0318:Cps1	UTSW	1	67177014	missense	probably damaging	0.99
R0486:Cps1	UTSW	1	67165392	missense	probably damaging	1.00
R0488:Cps1	UTSW	1	67148808	splice site	probably benign
R0492:Cps1	UTSW	1	67157836	missense	probably damaging	1.00
R0521:Cps1	UTSW	1	67215564	missense	probably benign	0.02
R0534:Cps1	UTSW	1	67143900	missense	probably benign	0.06
R0565:Cps1	UTSW	1	67166449	missense	possibly damaging	0.57
R0609:Cps1	UTSW	1	67172802	missense	probably damaging	1.00
R0612:Cps1	UTSW	1	67139770	missense	probably benign	0.01
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1220:Cps1	UTSW	1	67204703	critical splice donor site	probably null
R1321:Cps1	UTSW	1	67143019	splice site	probably benign
R1343:Cps1	UTSW	1	67209609	missense	probably damaging	1.00
R1373:Cps1	UTSW	1	67229424	missense	possibly damaging	0.89
R1374:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1481:Cps1	UTSW	1	67143882	missense	probably damaging	0.99
R1711:Cps1	UTSW	1	67168374	splice site	probably null
R1712:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1774:Cps1	UTSW	1	67170882	missense	possibly damaging	0.94
R1799:Cps1	UTSW	1	67209642	missense	probably damaging	1.00
R1954:Cps1	UTSW	1	67195196	missense	possibly damaging	0.71
R2074:Cps1	UTSW	1	67204638	missense	probably benign	0.21
R2078:Cps1	UTSW	1	67157806	missense	probably damaging	1.00
R2078:Cps1	UTSW	1	67195265	missense	possibly damaging	0.74
R2111:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2112:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2355:Cps1	UTSW	1	67156224	missense	probably damaging	1.00
R2375:Cps1	UTSW	1	67217860	missense	probably benign	0.00
R2860:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2861:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2979:Cps1	UTSW	1	67204704	critical splice donor site	probably null
R3427:Cps1	UTSW	1	67174494	missense	probably damaging	1.00
R3833:Cps1	UTSW	1	67139787	missense	probably damaging	1.00
R3857:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3858:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3859:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3886:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3887:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3888:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3889:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R4386:Cps1	UTSW	1	67170995	critical splice donor site	probably null
R4497:Cps1	UTSW	1	67205199	missense	probably null	1.00
R4671:Cps1	UTSW	1	67196560	missense	probably damaging	1.00
R4774:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R4799:Cps1	UTSW	1	67142986	missense	probably damaging	0.96
R4853:Cps1	UTSW	1	67156202	missense	possibly damaging	0.51
R4884:Cps1	UTSW	1	67177024	missense	probably benign	0.11
R4900:Cps1	UTSW	1	67160904	missense	probably damaging	1.00
R4906:Cps1	UTSW	1	67139763	missense	probably benign	0.10
R5091:Cps1	UTSW	1	67229520	critical splice donor site	probably null
R5102:Cps1	UTSW	1	67206793	missense	probably benign	0.00
R5215:Cps1	UTSW	1	67166380	missense	possibly damaging	0.62
R5290:Cps1	UTSW	1	67172709	missense	probably benign	0.21
R5732:Cps1	UTSW	1	67157764	missense	probably benign	0.22
R5818:Cps1	UTSW	1	67166488	missense	possibly damaging	0.96
R5878:Cps1	UTSW	1	67157878	critical splice donor site	probably null
R6002:Cps1	UTSW	1	67172755	missense	possibly damaging	0.94
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6199:Cps1	UTSW	1	67162615	frame shift	probably null
R6310:Cps1	UTSW	1	67142981	missense	probably benign	0.00
R6554:Cps1	UTSW	1	67174469	nonsense	probably null
R6700:Cps1	UTSW	1	67229523	splice site	probably null
R6731:Cps1	UTSW	1	67160871	missense	probably damaging	0.96
R7052:Cps1	UTSW	1	67198410	missense	probably damaging	1.00
R7278:Cps1	UTSW	1	67170921	missense	probably damaging	1.00
R7313:Cps1	UTSW	1	67198358	missense	probably damaging	0.99
R7323:Cps1	UTSW	1	67157869	missense	probably benign	0.03
R7339:Cps1	UTSW	1	67197015	missense	possibly damaging	0.64
R7485:Cps1	UTSW	1	67139857	missense	probably damaging	1.00
R7505:Cps1	UTSW	1	67180081	missense	probably benign
R7748:Cps1	UTSW	1	67139806	missense	probably damaging	1.00
R7853:Cps1	UTSW	1	67174481	missense	possibly damaging	0.92
R8097:Cps1	UTSW	1	67228270	missense	probably benign	0.08
R8357:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8435:Cps1	UTSW	1	67212430	missense	probably benign	0.07
R8457:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8680:Cps1	UTSW	1	67204613	missense	probably damaging	1.00
R8805:Cps1	UTSW	1	67176951	missense	probably damaging	1.00
R8811:Cps1	UTSW	1	67214087	missense	probably benign	0.03
R8819:Cps1	UTSW	1	67228280	missense	possibly damaging	0.56
R8820:Cps1	UTSW	1	67228280	missense	possibly damaging	0.56
R8854:Cps1	UTSW	1	67160889	missense	probably damaging	1.00
R9138:Cps1	UTSW	1	67215410	missense	probably damaging	1.00
R9185:Cps1	UTSW	1	67209672	missense	probably benign	0.08
R9273:Cps1	UTSW	1	67152286	missense	possibly damaging	0.69
R9286:Cps1	UTSW	1	67158871	missense	probably damaging	0.99
R9308:Cps1	UTSW	1	67160959	critical splice donor site	probably null
R9326:Cps1	UTSW	1	67209636	missense	probably damaging	1.00
R9449:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R9454:Cps1	UTSW	1	67180152	missense	probably damaging	0.97
R9518:Cps1	UTSW	1	67220503	missense	probably damaging	1.00
R9564:Cps1	UTSW	1	67158889	missense	probably benign	0.26
R9585:Cps1	UTSW	1	67156182	missense	probably damaging	0.99
R9618:Cps1	UTSW	1	67157816	missense	possibly damaging	0.87
R9641:Cps1	UTSW	1	67195183	missense	probably benign	0.03
R9650:Cps1	UTSW	1	67215477	missense
R9668:Cps1	UTSW	1	67174490	missense	probably benign	0.24
R9726:Cps1	UTSW	1	67156236	missense	probably benign	0.39
X0024:Cps1	UTSW	1	67123247	missense	probably benign
Z1176:Cps1	UTSW	1	67123268	missense	possibly damaging	0.54
Z1176:Cps1	UTSW	1	67148719	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTGAATTTACTGTCCAGGCCTG -3'
(R):5'- CTGAGCATTCACCAAATGGCC -3'

Sequencing Primer
(F):5'- CCAGGCCTGGTGCTTATTGC -3'
(R):5'- TGGCCTTAAGAAAACCCTGTTC -3'

Posted On

2014-10-01