Incidental Mutation 'R2146:Nup214'
ID233799
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Namenucleoporin 214
SynonymsCAN, D2H9S46E
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2146 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31974436-32053975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32034466 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1669 (S1669F)
Ref Sequence ENSEMBL: ENSMUSP00000066492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012]
Predicted Effect probably damaging
Transcript: ENSMUST00000065398
AA Change: S1669F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1669F

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123062
Predicted Effect possibly damaging
Transcript: ENSMUST00000138012
AA Change: S164F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S164F

DomainStartEndE-ValueType
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 137 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 181 210 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
low complexity region 294 327 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 373 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 544 572 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 32033979 missense probably damaging 1.00
IGL00649:Nup214 APN 2 32006721 missense probably benign 0.27
IGL01149:Nup214 APN 2 32034700 missense probably damaging 1.00
IGL01360:Nup214 APN 2 32038178 unclassified probably benign
IGL01409:Nup214 APN 2 32026931 splice site probably null
IGL01530:Nup214 APN 2 32033721 missense probably benign
IGL01554:Nup214 APN 2 32051072 nonsense probably null
IGL01944:Nup214 APN 2 32034959 nonsense probably null
IGL02296:Nup214 APN 2 31988188 missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31977860 missense probably damaging 1.00
IGL02688:Nup214 APN 2 32031275 missense probably benign
IGL02858:Nup214 APN 2 32010372 splice site probably benign
IGL02953:Nup214 APN 2 31988229 missense possibly damaging 0.87
IGL03090:Nup214 APN 2 32018242 missense probably benign 0.01
IGL03124:Nup214 APN 2 31996440 missense probably benign 0.27
IGL03225:Nup214 APN 2 32034411 missense probably damaging 1.00
IGL03375:Nup214 APN 2 32010221 missense probably damaging 0.97
Des_moines UTSW 2 31980584 splice site probably null
ANU74:Nup214 UTSW 2 32034966 missense probably damaging 0.99
R0035:Nup214 UTSW 2 31990367 splice site probably null
R0243:Nup214 UTSW 2 31998057 splice site probably benign
R0270:Nup214 UTSW 2 32034814 missense probably damaging 0.96
R0358:Nup214 UTSW 2 32004300 splice site probably null
R1168:Nup214 UTSW 2 32025301 missense probably benign
R1242:Nup214 UTSW 2 31977770 missense probably benign 0.00
R1481:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1482:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1579:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1580:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1581:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1610:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1894:Nup214 UTSW 2 31996380 missense possibly damaging 0.66
R2149:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2293:Nup214 UTSW 2 32026875 missense probably benign
R2924:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R2925:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R3037:Nup214 UTSW 2 31976620 missense probably benign 0.00
R3426:Nup214 UTSW 2 32033403 missense probably damaging 0.97
R3799:Nup214 UTSW 2 32034682 missense probably damaging 1.00
R3843:Nup214 UTSW 2 32051100 missense probably damaging 1.00
R4323:Nup214 UTSW 2 31994684 missense probably benign
R4353:Nup214 UTSW 2 31977917 critical splice donor site probably null
R4601:Nup214 UTSW 2 31997965 missense probably benign 0.36
R4626:Nup214 UTSW 2 32033404 missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31980584 splice site probably null
R4938:Nup214 UTSW 2 31983159 missense probably benign 0.00
R4939:Nup214 UTSW 2 31983159 missense probably benign 0.00
R5027:Nup214 UTSW 2 31991317 missense probably damaging 1.00
R5358:Nup214 UTSW 2 32017146 missense unknown
R5406:Nup214 UTSW 2 32002607 missense probably damaging 0.96
R5507:Nup214 UTSW 2 31988176 missense possibly damaging 0.87
R5695:Nup214 UTSW 2 32034373 missense probably damaging 1.00
R5744:Nup214 UTSW 2 32010296 missense probably damaging 0.97
R5908:Nup214 UTSW 2 31991341 missense probably benign 0.03
R5967:Nup214 UTSW 2 31979778 missense possibly damaging 0.52
R6140:Nup214 UTSW 2 32051796 missense possibly damaging 0.92
R6243:Nup214 UTSW 2 32002932 missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31991372 missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31982671 nonsense probably null
R6970:Nup214 UTSW 2 32051798 missense probably damaging 1.00
R7028:Nup214 UTSW 2 32034156 missense probably benign 0.22
R7114:Nup214 UTSW 2 32025244 missense possibly damaging 0.83
R7120:Nup214 UTSW 2 32051042 missense probably benign 0.07
R7249:Nup214 UTSW 2 31988233 missense possibly damaging 0.92
R7821:Nup214 UTSW 2 32026905 missense possibly damaging 0.83
RF015:Nup214 UTSW 2 32034706 missense probably benign 0.00
X0026:Nup214 UTSW 2 32020306 missense possibly damaging 0.46
X0065:Nup214 UTSW 2 32042476 missense probably damaging 1.00
Z1088:Nup214 UTSW 2 32011223 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATAGAGGCAGTGTCTCCTGC -3'
(R):5'- CTGCCCAAATGCTGTCTGTC -3'

Sequencing Primer
(F):5'- AACAGCTGTTCTCCCAGGAG -3'
(R):5'- AATGCTGTCTGTCCGAACAC -3'
Posted On2014-10-01