Incidental Mutation 'R2146:Rnf13'
ID233805
Institutional Source Beutler Lab
Gene Symbol Rnf13
Ensembl Gene ENSMUSG00000036503
Gene Namering finger protein 13
Synonyms2010001H16Rik, Rzf
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2146 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location57736062-57835233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57802486 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 150 (I150S)
Ref Sequence ENSEMBL: ENSMUSP00000142335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041826] [ENSMUST00000197205] [ENSMUST00000198214] [ENSMUST00000198249] [ENSMUST00000199041] [ENSMUST00000200497]
Predicted Effect probably null
Transcript: ENSMUST00000041826
AA Change: I150S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049331
Gene: ENSMUSG00000036503
AA Change: I150S

DomainStartEndE-ValueType
Pfam:PA 63 160 1.3e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
RING 240 281 1.85e-8 SMART
low complexity region 291 299 N/A INTRINSIC
low complexity region 336 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197205
SMART Domains Protein: ENSMUSP00000143692
Gene: ENSMUSG00000036503

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:PA 62 153 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197920
Predicted Effect probably null
Transcript: ENSMUST00000198214
AA Change: I150S

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143498
Gene: ENSMUSG00000036503
AA Change: I150S

DomainStartEndE-ValueType
Pfam:PA 63 160 5.1e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198249
AA Change: I123S

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142828
Gene: ENSMUSG00000036503
AA Change: I123S

DomainStartEndE-ValueType
Pfam:PA 33 131 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198996
Predicted Effect probably null
Transcript: ENSMUST00000199041
AA Change: I150S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142335
Gene: ENSMUSG00000036503
AA Change: I150S

DomainStartEndE-ValueType
Pfam:PA 59 162 6.6e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 2e-7 SMART
Blast:RING 240 267 5e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000200497
AA Change: I150S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142462
Gene: ENSMUSG00000036503
AA Change: I150S

DomainStartEndE-ValueType
Pfam:PA 59 162 1.1e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 1e-7 SMART
Blast:RING 240 261 9e-8 BLAST
low complexity region 262 270 N/A INTRINSIC
low complexity region 307 328 N/A INTRINSIC
Meta Mutation Damage Score 0.6453 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a member of the PA-TM-RING family of proteins that contain a protease associated (PA) domain and a RING finger domain separated by a transmembrane (TM) domain. The encoded protein is an E3 ubiquitin ligase localized to the endosomal-lysosomal vesicles and inner nuclear membrane. Mice lacking the encoded protein have impaired learning abilities associated with a decreased synaptic vesicle density and dysregulated SNARE complex assembly. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on the X chromosome. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Rnf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Rnf13 APN 3 57807087 missense probably benign 0.06
IGL01835:Rnf13 APN 3 57820586 missense probably damaging 1.00
IGL02219:Rnf13 APN 3 57796223 missense probably damaging 1.00
IGL02675:Rnf13 APN 3 57779396 missense probably benign 0.17
IGL03015:Rnf13 APN 3 57833744 missense possibly damaging 0.74
IGL03246:Rnf13 APN 3 57769050 missense probably damaging 0.98
R0147:Rnf13 UTSW 3 57802468 missense probably damaging 0.98
R0481:Rnf13 UTSW 3 57779451 missense probably damaging 1.00
R0481:Rnf13 UTSW 3 57807053 missense probably damaging 1.00
R1389:Rnf13 UTSW 3 57779496 missense probably damaging 1.00
R3964:Rnf13 UTSW 3 57769112 missense probably damaging 0.96
R4444:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4446:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4489:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4810:Rnf13 UTSW 3 57796272 missense probably damaging 0.99
R4940:Rnf13 UTSW 3 57796206 missense probably damaging 0.98
R6233:Rnf13 UTSW 3 57832970 missense possibly damaging 0.83
R7002:Rnf13 UTSW 3 57833612 missense probably damaging 0.96
R7622:Rnf13 UTSW 3 57820534 nonsense probably null
R7652:Rnf13 UTSW 3 57764351 missense probably benign 0.01
R8011:Rnf13 UTSW 3 57807070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTTGTAAGACTGTTGAGAGAAC -3'
(R):5'- TTAGCAACACTCTGGAGCATG -3'

Sequencing Primer
(F):5'- TTGAGAGAACTAAATGAACATGTGC -3'
(R):5'- ACAATCTTTTCCAGGGCAGTCAG -3'
Posted On2014-10-01