Mutagenetix > Incidental Mutation

Incidental Mutation 'R2146:Atg4c'

233812

Institutional Source

Beutler Lab

Gene Symbol

Atg4c

Ensembl Gene

ENSMUSG00000028550

Gene Name

autophagy related 4C, cysteine peptidase

Synonyms

Apg4-C, autophagin 3, Apg4c, Autl1

MMRRC Submission

040149-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R2146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99193934-99259787 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 99221226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 143 (N143K)

Ref Sequence

ENSEMBL: ENSMUSP00000137035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030279] [ENSMUST00000180278]

AlphaFold

Q811C2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030279
AA Change: N143K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030279
Gene: ENSMUSG00000028550
AA Change: N143K

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C54	76	400	7.4e-106	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152121

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180278
AA Change: N143K

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137035
Gene: ENSMUSG00000028550
AA Change: N143K

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C54	73	402	1.4e-119	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding the same protein, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a higher incidence of chemically-induced fibrosarcomas, and exhibit both a significant reduction of autophagic activity in the diaphragm muscle as well as decreased locomotor activity after prolonged starvation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,347,844		probably null	Het
4933406M09Rik	T	A	1: 134,390,513	M341K	probably damaging	Het
9530002B09Rik	T	A	4: 122,689,405	C13*	probably null	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Adamts18	G	C	8: 113,845,003	A116G	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap6	A	G	X: 168,796,500	T94A	probably benign	Het
Arhgef5	T	C	6: 43,283,318	S1413P	probably damaging	Het
BC005561	T	C	5: 104,518,991	F460L	probably benign	Het
C1qtnf12	A	G	4: 155,966,465	N297S	probably benign	Het
Cadps2	G	T	6: 23,838,999		probably benign	Het
Ccdc185	G	T	1: 182,747,520	H535N	possibly damaging	Het
Ccdc57	A	G	11: 120,885,225		probably benign	Het
Cd163	A	G	6: 124,309,208	H239R	probably damaging	Het
Ceacam2	G	T	7: 25,527,943	C166*	probably null	Het
Ces5a	T	A	8: 93,534,699	E33D	probably benign	Het
Chl1	T	C	6: 103,715,401		probably null	Het
Chsy3	G	A	18: 59,176,472	V266I	probably benign	Het
Cpa5	G	T	6: 30,626,822	R251L	probably damaging	Het
Cps1	A	C	1: 67,152,379		probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cstf1	T	C	2: 172,375,763	Y99H	probably damaging	Het
Cyp2j11	G	A	4: 96,316,358	T317I	probably damaging	Het
Dennd3	C	T	15: 73,523,496	T146M	probably damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dnah2	T	C	11: 69,515,761	M552V	probably benign	Het
Dnajc22	T	C	15: 99,104,383	V303A	probably benign	Het
Dtx2	T	G	5: 136,030,610	L458R	probably benign	Het
Elmsan1	G	T	12: 84,173,035	P382T	probably damaging	Het
Fat3	A	T	9: 15,990,512	F3072L	probably benign	Het
Fgf5	T	C	5: 98,275,550	*265R	probably null	Het
Fndc11	A	G	2: 181,222,125	E241G	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gm4922	T	G	10: 18,783,516	Q486P	probably benign	Het
Gm5786	A	T	12: 59,081,298		noncoding transcript	Het
Hepacam2	A	T	6: 3,463,378		probably benign	Het
Ints9	G	A	14: 64,986,343	G89R	possibly damaging	Het
Iqcm	T	A	8: 75,888,613	W441R	probably damaging	Het
Itga10	T	C	3: 96,651,492	L382P	possibly damaging	Het
Itga10	G	T	3: 96,653,723	G635W	probably damaging	Het
Kbtbd2	A	G	6: 56,779,090	Y554H	probably damaging	Het
Kif1b	T	C	4: 149,184,309	K1649R	probably damaging	Het
L1cam	A	T	X: 73,861,141	F536Y	probably damaging	Het
Magee1	A	T	X: 105,122,958	D783V	probably damaging	Het
Marveld3	A	T	8: 109,959,802	V144E	probably benign	Het
Mcam	T	C	9: 44,136,635	V59A	probably damaging	Het
Mdga2	C	T	12: 66,868,741	E47K	probably damaging	Het
Metrn	T	A	17: 25,796,627	E38V	probably damaging	Het
Mfrp	T	C	9: 44,103,718	L314P	probably benign	Het
Mospd2	A	G	X: 164,956,477		probably null	Het
Mycbp2	G	A	14: 103,155,922	H3068Y	probably damaging	Het
Myh6	C	T	14: 54,953,771	R871H	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1104	T	A	2: 87,021,665	N293I	probably damaging	Het
Olfr1465	T	C	19: 13,314,121	T55A	probably benign	Het
Olfr156	A	G	4: 43,821,178	F61S	probably damaging	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pdcd11	A	G	19: 47,104,752	M490V	probably benign	Het
Pet2	T	C	X: 89,406,277	D82G	possibly damaging	Het
Pkd2	A	C	5: 104,455,590		probably benign	Het
Reps1	T	A	10: 18,093,313	D206E	probably benign	Het
Rimkla	T	A	4: 119,474,582	M140L	possibly damaging	Het
Rnf13	T	G	3: 57,802,486	I150S	probably null	Het
Rxfp4	C	T	3: 88,652,893	A84T	probably damaging	Het
Serpinb8	T	A	1: 107,605,927	D237E	probably benign	Het
Sgo2b	T	G	8: 63,928,023	T592P	probably benign	Het
Slc35d1	A	T	4: 103,205,152	I228N	probably damaging	Het
Slc39a1	T	G	3: 90,249,450	H104Q	probably benign	Het
Slc6a6	T	C	6: 91,735,180	V230A	probably benign	Het
Slc9a3	A	G	13: 74,121,603	E30G	probably benign	Het
Slc9c1	A	G	16: 45,593,464	Y985C	probably benign	Het
Supt6	A	G	11: 78,230,932	F298S	probably damaging	Het
Tada2a	T	C	11: 84,079,629	D432G	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tnpo3	A	G	6: 29,589,036	V105A	probably benign	Het
Ttc7	T	C	17: 87,346,707		probably benign	Het
Ttn	T	C	2: 76,897,188		probably benign	Het
Usp16	T	C	16: 87,473,187		probably null	Het
Usp36	A	G	11: 118,268,665	L486S	probably benign	Het
Uty	T	C	Y: 1,239,816	I72V	probably benign	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Zfp160	A	G	17: 21,026,982	K598R	probably benign	Het
Zfp39	T	C	11: 58,890,332	N535D	probably benign	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Atg4c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01559:Atg4c	APN	4	99218203	splice site	probably benign
IGL02969:Atg4c	APN	4	99258387	splice site	probably benign
IGL03233:Atg4c	APN	4	99229503	missense	probably benign	0.06
R0083:Atg4c	UTSW	4	99221440	missense	possibly damaging	0.74
R0108:Atg4c	UTSW	4	99221440	missense	possibly damaging	0.74
R0485:Atg4c	UTSW	4	99224482	missense	probably benign	0.13
R1488:Atg4c	UTSW	4	99221242	missense	probably damaging	1.00
R1983:Atg4c	UTSW	4	99228575	missense	probably damaging	1.00
R2036:Atg4c	UTSW	4	99218139	missense	possibly damaging	0.89
R2148:Atg4c	UTSW	4	99221226	missense	possibly damaging	0.89
R2150:Atg4c	UTSW	4	99221226	missense	possibly damaging	0.89
R5715:Atg4c	UTSW	4	99258402	missense	probably damaging	1.00
R5854:Atg4c	UTSW	4	99228559	missense	probably benign
R6157:Atg4c	UTSW	4	99235163	nonsense	probably null
R7431:Atg4c	UTSW	4	99221395	missense	possibly damaging	0.93
R7570:Atg4c	UTSW	4	99228560	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- TCCGCCTTTGCACAGATTTG -3'
(R):5'- CAAACTCTATCAGACGATGTAAGC -3'

Sequencing Primer
(F):5'- GCCTTTGCACAGATTTGAGTTTC -3'
(R):5'- ACCAAGAGATGATCTTCCTGTG -3'

Posted On

2014-10-01