Mutagenetix > Incidental Mutation

Incidental Mutation 'R2146:Arhgef5'

233826

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

040149-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43283318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1413 (S1413P)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: S1413P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S1413P

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: S681P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Meta Mutation Damage Score

0.6251

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,347,844		probably null	Het
4933406M09Rik	T	A	1: 134,390,513	M341K	probably damaging	Het
9530002B09Rik	T	A	4: 122,689,405	C13*	probably null	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Adamts18	G	C	8: 113,845,003	A116G	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap6	A	G	X: 168,796,500	T94A	probably benign	Het
Atg4c	C	A	4: 99,221,226	N143K	possibly damaging	Het
BC005561	T	C	5: 104,518,991	F460L	probably benign	Het
C1qtnf12	A	G	4: 155,966,465	N297S	probably benign	Het
Cadps2	G	T	6: 23,838,999		probably benign	Het
Ccdc185	G	T	1: 182,747,520	H535N	possibly damaging	Het
Ccdc57	A	G	11: 120,885,225		probably benign	Het
Cd163	A	G	6: 124,309,208	H239R	probably damaging	Het
Ceacam2	G	T	7: 25,527,943	C166*	probably null	Het
Ces5a	T	A	8: 93,534,699	E33D	probably benign	Het
Chl1	T	C	6: 103,715,401		probably null	Het
Chsy3	G	A	18: 59,176,472	V266I	probably benign	Het
Cpa5	G	T	6: 30,626,822	R251L	probably damaging	Het
Cps1	A	C	1: 67,152,379		probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cstf1	T	C	2: 172,375,763	Y99H	probably damaging	Het
Cyp2j11	G	A	4: 96,316,358	T317I	probably damaging	Het
Dennd3	C	T	15: 73,523,496	T146M	probably damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dnah2	T	C	11: 69,515,761	M552V	probably benign	Het
Dnajc22	T	C	15: 99,104,383	V303A	probably benign	Het
Dtx2	T	G	5: 136,030,610	L458R	probably benign	Het
Elmsan1	G	T	12: 84,173,035	P382T	probably damaging	Het
Fat3	A	T	9: 15,990,512	F3072L	probably benign	Het
Fgf5	T	C	5: 98,275,550	*265R	probably null	Het
Fndc11	A	G	2: 181,222,125	E241G	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gm4922	T	G	10: 18,783,516	Q486P	probably benign	Het
Gm5786	A	T	12: 59,081,298		noncoding transcript	Het
Hepacam2	A	T	6: 3,463,378		probably benign	Het
Ints9	G	A	14: 64,986,343	G89R	possibly damaging	Het
Iqcm	T	A	8: 75,888,613	W441R	probably damaging	Het
Itga10	T	C	3: 96,651,492	L382P	possibly damaging	Het
Itga10	G	T	3: 96,653,723	G635W	probably damaging	Het
Kbtbd2	A	G	6: 56,779,090	Y554H	probably damaging	Het
Kif1b	T	C	4: 149,184,309	K1649R	probably damaging	Het
L1cam	A	T	X: 73,861,141	F536Y	probably damaging	Het
Magee1	A	T	X: 105,122,958	D783V	probably damaging	Het
Marveld3	A	T	8: 109,959,802	V144E	probably benign	Het
Mcam	T	C	9: 44,136,635	V59A	probably damaging	Het
Mdga2	C	T	12: 66,868,741	E47K	probably damaging	Het
Metrn	T	A	17: 25,796,627	E38V	probably damaging	Het
Mfrp	T	C	9: 44,103,718	L314P	probably benign	Het
Mospd2	A	G	X: 164,956,477		probably null	Het
Mycbp2	G	A	14: 103,155,922	H3068Y	probably damaging	Het
Myh6	C	T	14: 54,953,771	R871H	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1104	T	A	2: 87,021,665	N293I	probably damaging	Het
Olfr1465	T	C	19: 13,314,121	T55A	probably benign	Het
Olfr156	A	G	4: 43,821,178	F61S	probably damaging	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pdcd11	A	G	19: 47,104,752	M490V	probably benign	Het
Pet2	T	C	X: 89,406,277	D82G	possibly damaging	Het
Pkd2	A	C	5: 104,455,590		probably benign	Het
Reps1	T	A	10: 18,093,313	D206E	probably benign	Het
Rimkla	T	A	4: 119,474,582	M140L	possibly damaging	Het
Rnf13	T	G	3: 57,802,486	I150S	probably null	Het
Rxfp4	C	T	3: 88,652,893	A84T	probably damaging	Het
Serpinb8	T	A	1: 107,605,927	D237E	probably benign	Het
Sgo2b	T	G	8: 63,928,023	T592P	probably benign	Het
Slc35d1	A	T	4: 103,205,152	I228N	probably damaging	Het
Slc39a1	T	G	3: 90,249,450	H104Q	probably benign	Het
Slc6a6	T	C	6: 91,735,180	V230A	probably benign	Het
Slc9a3	A	G	13: 74,121,603	E30G	probably benign	Het
Slc9c1	A	G	16: 45,593,464	Y985C	probably benign	Het
Supt6	A	G	11: 78,230,932	F298S	probably damaging	Het
Tada2a	T	C	11: 84,079,629	D432G	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tnpo3	A	G	6: 29,589,036	V105A	probably benign	Het
Ttc7	T	C	17: 87,346,707		probably benign	Het
Ttn	T	C	2: 76,897,188		probably benign	Het
Usp16	T	C	16: 87,473,187		probably null	Het
Usp36	A	G	11: 118,268,665	L486S	probably benign	Het
Uty	T	C	Y: 1,239,816	I72V	probably benign	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Zfp160	A	G	17: 21,026,982	K598R	probably benign	Het
Zfp39	T	C	11: 58,890,332	N535D	probably benign	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCAGGACTAACAGGACACTC -3'
(R):5'- TGAAAAGACAACATCTCGTGC -3'

Sequencing Primer
(F):5'- GGACACTCATCACCTGCGTC -3'
(R):5'- TGTCTATAACACAGGACAGGTTTGG -3'

Posted On

2014-10-01