Incidental Mutation 'R2146:Chl1'
ID 233830
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Name cell adhesion molecule L1-like
Synonyms A530023M13Rik, close homolog of L1, LICAM2, CALL
MMRRC Submission 040149-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.524) question?
Stock # R2146 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 103487372-103709999 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 103692362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
AlphaFold P70232
Predicted Effect probably null
Transcript: ENSMUST00000066905
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203830
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203912
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205098
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,324,803 (GRCm39) probably null Het
9530002B09Rik T A 4: 122,583,198 (GRCm39) C13* probably null Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Adamts18 G C 8: 114,571,635 (GRCm39) A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap6 A G X: 167,579,496 (GRCm39) T94A probably benign Het
Arhgef5 T C 6: 43,260,252 (GRCm39) S1413P probably damaging Het
Atg4c C A 4: 99,109,463 (GRCm39) N143K possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Cadps2 G T 6: 23,838,998 (GRCm39) probably benign Het
Ccdc185 G T 1: 182,575,085 (GRCm39) H535N possibly damaging Het
Ccdc57 A G 11: 120,776,051 (GRCm39) probably benign Het
Cd163 A G 6: 124,286,167 (GRCm39) H239R probably damaging Het
Ceacam2 G T 7: 25,227,368 (GRCm39) C166* probably null Het
Ces5a T A 8: 94,261,327 (GRCm39) E33D probably benign Het
Chsy3 G A 18: 59,309,544 (GRCm39) V266I probably benign Het
Cpa5 G T 6: 30,626,821 (GRCm39) R251L probably damaging Het
Cps1 A C 1: 67,191,538 (GRCm39) probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cstf1 T C 2: 172,217,683 (GRCm39) Y99H probably damaging Het
Cyp2j11 G A 4: 96,204,595 (GRCm39) T317I probably damaging Het
Dcaf8l T C X: 88,449,883 (GRCm39) D82G possibly damaging Het
Dennd3 C T 15: 73,395,345 (GRCm39) T146M probably damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dnajc22 T C 15: 99,002,264 (GRCm39) V303A probably benign Het
Dtx2 T G 5: 136,059,464 (GRCm39) L458R probably benign Het
Fat3 A T 9: 15,901,808 (GRCm39) F3072L probably benign Het
Fgf5 T C 5: 98,423,409 (GRCm39) *265R probably null Het
Fndc11 A G 2: 180,863,918 (GRCm39) E241G probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gm4922 T G 10: 18,659,264 (GRCm39) Q486P probably benign Het
Gm5786 A T 12: 59,128,084 (GRCm39) noncoding transcript Het
Hepacam2 A T 6: 3,463,378 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,792 (GRCm39) G89R possibly damaging Het
Iqcm T A 8: 76,615,241 (GRCm39) W441R probably damaging Het
Itga10 T C 3: 96,558,808 (GRCm39) L382P possibly damaging Het
Itga10 G T 3: 96,561,039 (GRCm39) G635W probably damaging Het
Kbtbd2 A G 6: 56,756,075 (GRCm39) Y554H probably damaging Het
Kif1b T C 4: 149,268,766 (GRCm39) K1649R probably damaging Het
L1cam A T X: 72,904,747 (GRCm39) F536Y probably damaging Het
Magee1 A T X: 104,166,564 (GRCm39) D783V probably damaging Het
Marveld3 A T 8: 110,686,434 (GRCm39) V144E probably benign Het
Mcam T C 9: 44,047,932 (GRCm39) V59A probably damaging Het
Mdga2 C T 12: 66,915,515 (GRCm39) E47K probably damaging Het
Metrn T A 17: 26,015,601 (GRCm39) E38V probably damaging Het
Mfrp T C 9: 44,015,015 (GRCm39) L314P probably benign Het
Mgat4f T A 1: 134,318,251 (GRCm39) M341K probably damaging Het
Mideas G T 12: 84,219,809 (GRCm39) P382T probably damaging Het
Mospd2 A G X: 163,739,473 (GRCm39) probably null Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myh6 C T 14: 55,191,228 (GRCm39) R871H probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Or13c7b A G 4: 43,821,178 (GRCm39) F61S probably damaging Het
Or5b111 T C 19: 13,291,485 (GRCm39) T55A probably benign Het
Or8i2 T A 2: 86,852,009 (GRCm39) N293I probably damaging Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pdcd11 A G 19: 47,093,191 (GRCm39) M490V probably benign Het
Pkd2 A C 5: 104,603,456 (GRCm39) probably benign Het
Reps1 T A 10: 17,969,061 (GRCm39) D206E probably benign Het
Rimkla T A 4: 119,331,779 (GRCm39) M140L possibly damaging Het
Rnf13 T G 3: 57,709,907 (GRCm39) I150S probably null Het
Rxfp4 C T 3: 88,560,200 (GRCm39) A84T probably damaging Het
Serpinb8 T A 1: 107,533,657 (GRCm39) D237E probably benign Het
Sgo2b T G 8: 64,381,057 (GRCm39) T592P probably benign Het
Slc35d1 A T 4: 103,062,349 (GRCm39) I228N probably damaging Het
Slc39a1 T G 3: 90,156,757 (GRCm39) H104Q probably benign Het
Slc6a6 T C 6: 91,712,161 (GRCm39) V230A probably benign Het
Slc9a3 A G 13: 74,269,722 (GRCm39) E30G probably benign Het
Slc9c1 A G 16: 45,413,827 (GRCm39) Y985C probably benign Het
Supt6 A G 11: 78,121,758 (GRCm39) F298S probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Thoc2l T C 5: 104,666,857 (GRCm39) F460L probably benign Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tnpo3 A G 6: 29,589,035 (GRCm39) V105A probably benign Het
Ttc7 T C 17: 87,654,135 (GRCm39) probably benign Het
Ttn T C 2: 76,727,532 (GRCm39) probably benign Het
Usp16 T C 16: 87,270,075 (GRCm39) probably null Het
Usp36 A G 11: 118,159,491 (GRCm39) L486S probably benign Het
Uty T C Y: 1,239,816 (GRCm39) I72V probably benign Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Zfp160 A G 17: 21,247,244 (GRCm39) K598R probably benign Het
Zfp39 T C 11: 58,781,158 (GRCm39) N535D probably benign Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103,670,022 (GRCm39) missense probably benign 0.08
IGL00786:Chl1 APN 6 103,652,106 (GRCm39) missense probably damaging 1.00
IGL00959:Chl1 APN 6 103,686,211 (GRCm39) splice site probably null
IGL01109:Chl1 APN 6 103,692,354 (GRCm39) missense probably damaging 1.00
IGL01354:Chl1 APN 6 103,642,814 (GRCm39) missense probably benign 0.01
IGL01367:Chl1 APN 6 103,706,186 (GRCm39) missense probably benign 0.42
IGL01371:Chl1 APN 6 103,692,325 (GRCm39) missense probably damaging 1.00
IGL01599:Chl1 APN 6 103,685,445 (GRCm39) missense probably benign 0.34
IGL01724:Chl1 APN 6 103,626,534 (GRCm39) missense probably damaging 1.00
IGL02001:Chl1 APN 6 103,619,017 (GRCm39) missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103,675,185 (GRCm39) missense probably benign 0.39
IGL02122:Chl1 APN 6 103,652,098 (GRCm39) missense probably benign 0.39
IGL02340:Chl1 APN 6 103,675,086 (GRCm39) missense probably damaging 1.00
IGL02420:Chl1 APN 6 103,692,330 (GRCm39) missense probably damaging 1.00
IGL02421:Chl1 APN 6 103,694,541 (GRCm39) missense probably damaging 1.00
IGL02429:Chl1 APN 6 103,641,770 (GRCm39) unclassified probably benign
IGL02825:Chl1 APN 6 103,645,764 (GRCm39) missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103,618,949 (GRCm39) missense probably damaging 1.00
IGL03169:Chl1 APN 6 103,642,928 (GRCm39) missense probably damaging 1.00
IGL03185:Chl1 APN 6 103,642,824 (GRCm39) missense probably damaging 1.00
IGL03189:Chl1 APN 6 103,660,168 (GRCm39) missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103,652,058 (GRCm39) missense probably damaging 1.00
IGL03404:Chl1 APN 6 103,670,052 (GRCm39) missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103,668,628 (GRCm39) missense probably benign 0.01
R0060:Chl1 UTSW 6 103,688,019 (GRCm39) splice site probably benign
R0060:Chl1 UTSW 6 103,688,019 (GRCm39) splice site probably benign
R0062:Chl1 UTSW 6 103,726,613 (GRCm39) missense unknown
R0314:Chl1 UTSW 6 103,624,262 (GRCm39) missense probably damaging 1.00
R0322:Chl1 UTSW 6 103,678,844 (GRCm39) splice site probably benign
R0685:Chl1 UTSW 6 103,685,503 (GRCm39) splice site probably null
R0702:Chl1 UTSW 6 103,683,583 (GRCm39) missense probably damaging 1.00
R1056:Chl1 UTSW 6 103,652,038 (GRCm39) missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103,670,140 (GRCm39) missense probably benign 0.05
R1483:Chl1 UTSW 6 103,624,248 (GRCm39) missense probably damaging 1.00
R1571:Chl1 UTSW 6 103,685,445 (GRCm39) missense probably benign 0.34
R1620:Chl1 UTSW 6 103,667,203 (GRCm39) missense probably benign 0.00
R1645:Chl1 UTSW 6 103,660,141 (GRCm39) missense probably benign 0.06
R1773:Chl1 UTSW 6 103,624,292 (GRCm39) critical splice donor site probably null
R1852:Chl1 UTSW 6 103,676,120 (GRCm39) splice site probably null
R1891:Chl1 UTSW 6 103,691,544 (GRCm39) missense possibly damaging 0.88
R2147:Chl1 UTSW 6 103,692,362 (GRCm39) critical splice donor site probably null
R2148:Chl1 UTSW 6 103,692,362 (GRCm39) critical splice donor site probably null
R2163:Chl1 UTSW 6 103,688,192 (GRCm39) missense probably damaging 1.00
R2291:Chl1 UTSW 6 103,692,354 (GRCm39) missense probably damaging 1.00
R2920:Chl1 UTSW 6 103,672,304 (GRCm39) missense probably damaging 1.00
R3611:Chl1 UTSW 6 103,675,116 (GRCm39) missense probably damaging 1.00
R3979:Chl1 UTSW 6 103,692,245 (GRCm39) nonsense probably null
R4987:Chl1 UTSW 6 103,651,938 (GRCm39) missense probably damaging 1.00
R5266:Chl1 UTSW 6 103,677,504 (GRCm39) missense probably damaging 1.00
R5478:Chl1 UTSW 6 103,660,182 (GRCm39) missense probably damaging 1.00
R5523:Chl1 UTSW 6 103,685,675 (GRCm39) missense probably damaging 1.00
R5887:Chl1 UTSW 6 103,694,565 (GRCm39) missense probably benign 0.00
R5986:Chl1 UTSW 6 103,686,152 (GRCm39) missense probably benign 0.45
R6101:Chl1 UTSW 6 103,669,993 (GRCm39) missense probably damaging 0.96
R6179:Chl1 UTSW 6 103,660,204 (GRCm39) missense probably benign 0.38
R6366:Chl1 UTSW 6 103,706,197 (GRCm39) missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103,667,220 (GRCm39) missense probably damaging 1.00
R6824:Chl1 UTSW 6 103,691,510 (GRCm39) missense probably damaging 1.00
R6913:Chl1 UTSW 6 103,642,909 (GRCm39) nonsense probably null
R7097:Chl1 UTSW 6 103,683,409 (GRCm39) missense probably damaging 1.00
R7122:Chl1 UTSW 6 103,683,409 (GRCm39) missense probably damaging 1.00
R7198:Chl1 UTSW 6 103,683,517 (GRCm39) missense probably damaging 1.00
R7203:Chl1 UTSW 6 103,668,635 (GRCm39) missense probably benign 0.13
R7527:Chl1 UTSW 6 103,688,162 (GRCm39) missense probably damaging 1.00
R7625:Chl1 UTSW 6 103,706,086 (GRCm39) missense probably damaging 1.00
R7667:Chl1 UTSW 6 103,672,456 (GRCm39) missense possibly damaging 0.82
R7683:Chl1 UTSW 6 103,668,613 (GRCm39) missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103,688,063 (GRCm39) missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103,668,635 (GRCm39) missense probably benign 0.01
R7863:Chl1 UTSW 6 103,683,475 (GRCm39) missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103,667,224 (GRCm39) missense probably benign 0.22
R7998:Chl1 UTSW 6 103,706,250 (GRCm39) missense probably benign 0.01
R8044:Chl1 UTSW 6 103,683,593 (GRCm39) missense probably damaging 0.96
R8059:Chl1 UTSW 6 103,651,948 (GRCm39) missense probably damaging 0.97
R8462:Chl1 UTSW 6 103,706,130 (GRCm39) missense probably benign 0.11
R8558:Chl1 UTSW 6 103,685,390 (GRCm39) missense probably benign 0.14
R8827:Chl1 UTSW 6 103,670,111 (GRCm39) missense probably benign
R8865:Chl1 UTSW 6 103,685,822 (GRCm39) missense probably damaging 0.99
R8939:Chl1 UTSW 6 103,642,868 (GRCm39) missense probably damaging 1.00
R9092:Chl1 UTSW 6 103,645,815 (GRCm39) unclassified probably benign
Z1177:Chl1 UTSW 6 103,674,910 (GRCm39) start gained probably benign
Z1177:Chl1 UTSW 6 103,670,057 (GRCm39) nonsense probably null
Z1191:Chl1 UTSW 6 103,660,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTCAACGTTGTGCCTTC -3'
(R):5'- TGTAGTCCCTTTGGCATTCTAAG -3'

Sequencing Primer
(F):5'- GTTGTGCCTTCTCTCTGTACAAC -3'
(R):5'- CTACCTAGTGAGTTTTAGGACAGCC -3'
Posted On 2014-10-01