Mutagenetix > Incidental Mutation

Incidental Mutation 'R2146:Sgo2b'

233833

Institutional Source

Beutler Lab

Gene Symbol

Sgo2b

Ensembl Gene

ENSMUSG00000094443

Gene Name

shugoshin 2B

Synonyms

Sgol2b, Gm4975

MMRRC Submission

040149-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R2146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63924694-63952248 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 63928023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 592 (T592P)

Ref Sequence

ENSEMBL: ENSMUSP00000136323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179944]

AlphaFold

J3QMK1

Predicted Effect

probably benign
Transcript: ENSMUST00000179944
AA Change: T592P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: T592P

Domain	Start	End	E-Value	Type
coiled coil region	54	113	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	163	172	N/A	INTRINSIC
low complexity region	400	414	N/A	INTRINSIC
internal_repeat_1	528	618	9.12e-8	PROSPERO
internal_repeat_1	713	809	9.12e-8	PROSPERO
low complexity region	1009	1024	N/A	INTRINSIC
low complexity region	1059	1081	N/A	INTRINSIC
low complexity region	1112	1126	N/A	INTRINSIC
low complexity region	1130	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210915

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (84/85)

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,347,844		probably null	Het
4933406M09Rik	T	A	1: 134,390,513	M341K	probably damaging	Het
9530002B09Rik	T	A	4: 122,689,405	C13*	probably null	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Adamts18	G	C	8: 113,845,003	A116G	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap6	A	G	X: 168,796,500	T94A	probably benign	Het
Arhgef5	T	C	6: 43,283,318	S1413P	probably damaging	Het
Atg4c	C	A	4: 99,221,226	N143K	possibly damaging	Het
BC005561	T	C	5: 104,518,991	F460L	probably benign	Het
C1qtnf12	A	G	4: 155,966,465	N297S	probably benign	Het
Cadps2	G	T	6: 23,838,999		probably benign	Het
Ccdc185	G	T	1: 182,747,520	H535N	possibly damaging	Het
Ccdc57	A	G	11: 120,885,225		probably benign	Het
Cd163	A	G	6: 124,309,208	H239R	probably damaging	Het
Ceacam2	G	T	7: 25,527,943	C166*	probably null	Het
Ces5a	T	A	8: 93,534,699	E33D	probably benign	Het
Chl1	T	C	6: 103,715,401		probably null	Het
Chsy3	G	A	18: 59,176,472	V266I	probably benign	Het
Cpa5	G	T	6: 30,626,822	R251L	probably damaging	Het
Cps1	A	C	1: 67,152,379		probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cstf1	T	C	2: 172,375,763	Y99H	probably damaging	Het
Cyp2j11	G	A	4: 96,316,358	T317I	probably damaging	Het
Dennd3	C	T	15: 73,523,496	T146M	probably damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dnah2	T	C	11: 69,515,761	M552V	probably benign	Het
Dnajc22	T	C	15: 99,104,383	V303A	probably benign	Het
Dtx2	T	G	5: 136,030,610	L458R	probably benign	Het
Elmsan1	G	T	12: 84,173,035	P382T	probably damaging	Het
Fat3	A	T	9: 15,990,512	F3072L	probably benign	Het
Fgf5	T	C	5: 98,275,550	*265R	probably null	Het
Fndc11	A	G	2: 181,222,125	E241G	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gm4922	T	G	10: 18,783,516	Q486P	probably benign	Het
Gm5786	A	T	12: 59,081,298		noncoding transcript	Het
Hepacam2	A	T	6: 3,463,378		probably benign	Het
Ints9	G	A	14: 64,986,343	G89R	possibly damaging	Het
Iqcm	T	A	8: 75,888,613	W441R	probably damaging	Het
Itga10	T	C	3: 96,651,492	L382P	possibly damaging	Het
Itga10	G	T	3: 96,653,723	G635W	probably damaging	Het
Kbtbd2	A	G	6: 56,779,090	Y554H	probably damaging	Het
Kif1b	T	C	4: 149,184,309	K1649R	probably damaging	Het
L1cam	A	T	X: 73,861,141	F536Y	probably damaging	Het
Magee1	A	T	X: 105,122,958	D783V	probably damaging	Het
Marveld3	A	T	8: 109,959,802	V144E	probably benign	Het
Mcam	T	C	9: 44,136,635	V59A	probably damaging	Het
Mdga2	C	T	12: 66,868,741	E47K	probably damaging	Het
Metrn	T	A	17: 25,796,627	E38V	probably damaging	Het
Mfrp	T	C	9: 44,103,718	L314P	probably benign	Het
Mospd2	A	G	X: 164,956,477		probably null	Het
Mycbp2	G	A	14: 103,155,922	H3068Y	probably damaging	Het
Myh6	C	T	14: 54,953,771	R871H	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1104	T	A	2: 87,021,665	N293I	probably damaging	Het
Olfr1465	T	C	19: 13,314,121	T55A	probably benign	Het
Olfr156	A	G	4: 43,821,178	F61S	probably damaging	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pdcd11	A	G	19: 47,104,752	M490V	probably benign	Het
Pet2	T	C	X: 89,406,277	D82G	possibly damaging	Het
Pkd2	A	C	5: 104,455,590		probably benign	Het
Reps1	T	A	10: 18,093,313	D206E	probably benign	Het
Rimkla	T	A	4: 119,474,582	M140L	possibly damaging	Het
Rnf13	T	G	3: 57,802,486	I150S	probably null	Het
Rxfp4	C	T	3: 88,652,893	A84T	probably damaging	Het
Serpinb8	T	A	1: 107,605,927	D237E	probably benign	Het
Slc35d1	A	T	4: 103,205,152	I228N	probably damaging	Het
Slc39a1	T	G	3: 90,249,450	H104Q	probably benign	Het
Slc6a6	T	C	6: 91,735,180	V230A	probably benign	Het
Slc9a3	A	G	13: 74,121,603	E30G	probably benign	Het
Slc9c1	A	G	16: 45,593,464	Y985C	probably benign	Het
Supt6	A	G	11: 78,230,932	F298S	probably damaging	Het
Tada2a	T	C	11: 84,079,629	D432G	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tnpo3	A	G	6: 29,589,036	V105A	probably benign	Het
Ttc7	T	C	17: 87,346,707		probably benign	Het
Ttn	T	C	2: 76,897,188		probably benign	Het
Usp16	T	C	16: 87,473,187		probably null	Het
Usp36	A	G	11: 118,268,665	L486S	probably benign	Het
Uty	T	C	Y: 1,239,816	I72V	probably benign	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Zfp160	A	G	17: 21,026,982	K598R	probably benign	Het
Zfp39	T	C	11: 58,890,332	N535D	probably benign	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Sgo2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sgo2b	APN	8	63926523	missense	probably benign
IGL01343:Sgo2b	APN	8	63927315	nonsense	probably null
IGL02027:Sgo2b	APN	8	63926829	missense	probably benign
IGL02090:Sgo2b	APN	8	63927089	missense	probably damaging	0.99
IGL02121:Sgo2b	APN	8	63931282	missense	possibly damaging	0.94
IGL02206:Sgo2b	APN	8	63941084	missense	possibly damaging	0.94
IGL02554:Sgo2b	APN	8	63926537	missense	probably damaging	0.96
IGL02663:Sgo2b	APN	8	63943114	missense	probably damaging	0.97
IGL03149:Sgo2b	APN	8	63926583	missense	probably benign	0.14
floater	UTSW	8	63938417	nonsense	probably null
R0164:Sgo2b	UTSW	8	63938383	missense	possibly damaging	0.92
R0164:Sgo2b	UTSW	8	63938383	missense	possibly damaging	0.92
R0201:Sgo2b	UTSW	8	63926636	missense	probably benign
R0285:Sgo2b	UTSW	8	63928789	nonsense	probably null
R0325:Sgo2b	UTSW	8	63928376	missense	probably benign	0.20
R0727:Sgo2b	UTSW	8	63927782	missense	probably damaging	0.98
R0943:Sgo2b	UTSW	8	63931335	missense	possibly damaging	0.82
R1148:Sgo2b	UTSW	8	63926855	missense	probably damaging	0.99
R1266:Sgo2b	UTSW	8	63928421	missense	probably benign	0.00
R1484:Sgo2b	UTSW	8	63931473	missense	possibly damaging	0.77
R1493:Sgo2b	UTSW	8	63926855	missense	probably damaging	0.99
R1537:Sgo2b	UTSW	8	63926502	missense	possibly damaging	0.94
R1630:Sgo2b	UTSW	8	63927797	missense	possibly damaging	0.90
R1803:Sgo2b	UTSW	8	63927392	missense	probably benign	0.01
R1912:Sgo2b	UTSW	8	63931469	missense	probably damaging	0.98
R1993:Sgo2b	UTSW	8	63926833	missense	probably benign	0.36
R2042:Sgo2b	UTSW	8	63928527	missense	probably benign
R2130:Sgo2b	UTSW	8	63927147	missense	probably benign	0.09
R2881:Sgo2b	UTSW	8	63927536	missense	probably damaging	0.99
R3686:Sgo2b	UTSW	8	63931327	missense	probably benign	0.20
R3706:Sgo2b	UTSW	8	63928145	missense	probably damaging	0.98
R3889:Sgo2b	UTSW	8	63927743	missense	possibly damaging	0.82
R3894:Sgo2b	UTSW	8	63928733	missense	possibly damaging	0.91
R3895:Sgo2b	UTSW	8	63928733	missense	possibly damaging	0.91
R4058:Sgo2b	UTSW	8	63926947	missense	probably damaging	0.98
R4259:Sgo2b	UTSW	8	63928296	missense	probably benign	0.06
R4260:Sgo2b	UTSW	8	63928296	missense	probably benign	0.06
R4704:Sgo2b	UTSW	8	63927790	missense	probably damaging	0.98
R4815:Sgo2b	UTSW	8	63931414	missense	probably benign
R4922:Sgo2b	UTSW	8	63926630	missense	possibly damaging	0.66
R5232:Sgo2b	UTSW	8	63928602	missense	possibly damaging	0.55
R5262:Sgo2b	UTSW	8	63943137	missense	probably damaging	0.99
R5444:Sgo2b	UTSW	8	63926556	missense	possibly damaging	0.90
R5677:Sgo2b	UTSW	8	63926974	missense	possibly damaging	0.77
R5959:Sgo2b	UTSW	8	63927288	missense	probably benign	0.01
R6004:Sgo2b	UTSW	8	63926673	nonsense	probably null
R6267:Sgo2b	UTSW	8	63927793	missense	probably benign
R6296:Sgo2b	UTSW	8	63927793	missense	probably benign
R6328:Sgo2b	UTSW	8	63928311	nonsense	probably null
R6517:Sgo2b	UTSW	8	63931494	missense	probably damaging	0.99
R6523:Sgo2b	UTSW	8	63927504	missense	probably benign	0.11
R6726:Sgo2b	UTSW	8	63927735	nonsense	probably null
R6957:Sgo2b	UTSW	8	63931455	small deletion	probably benign
R7031:Sgo2b	UTSW	8	63940044	missense	possibly damaging	0.94
R7034:Sgo2b	UTSW	8	63926834	missense	probably benign	0.36
R7145:Sgo2b	UTSW	8	63928184	missense	probably damaging	1.00
R7289:Sgo2b	UTSW	8	63941158	missense	probably damaging	0.97
R7366:Sgo2b	UTSW	8	63938417	nonsense	probably null
R7660:Sgo2b	UTSW	8	63940074	missense	probably benign	0.27
R7761:Sgo2b	UTSW	8	63926912	missense	probably benign
R7762:Sgo2b	UTSW	8	63926497	missense	probably benign	0.03
R7822:Sgo2b	UTSW	8	63927284	missense	probably damaging	0.98
R8111:Sgo2b	UTSW	8	63943104	missense	probably damaging	0.98
R8129:Sgo2b	UTSW	8	63928800	missense	possibly damaging	0.90
R8273:Sgo2b	UTSW	8	63924701	missense	unknown
R8856:Sgo2b	UTSW	8	63940057	missense	probably null	0.99
R9249:Sgo2b	UTSW	8	63938373	nonsense	probably null
R9428:Sgo2b	UTSW	8	63940033	missense	probably damaging	0.99
R9616:Sgo2b	UTSW	8	63927240	missense	probably benign
R9621:Sgo2b	UTSW	8	63927617	missense	probably damaging	0.99
RF014:Sgo2b	UTSW	8	63931405	missense	possibly damaging	0.94
RF055:Sgo2b	UTSW	8	63943169	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	63927005	missense	probably damaging	1.00
Z1088:Sgo2b	UTSW	8	63928422	missense	possibly damaging	0.61
Z1177:Sgo2b	UTSW	8	63927439	missense	probably benign	0.03
Z1177:Sgo2b	UTSW	8	63928385	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CGCAAGCTTCCATTAACTCTTG -3'
(R):5'- CCTTCTCGACAGACATTTGTGATTC -3'

Sequencing Primer
(F):5'- GCAAGCTTCCATTAACTCTTGTGAAG -3'
(R):5'- CGACAGACATTTGTGATTCATAAATC -3'

Posted On

2014-10-01