Incidental Mutation 'R2146:Zfp39'
ID233847
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Namezinc finger protein 39
SynonymsZfp-39, CTfin33
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2146 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58888153-58904225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58890332 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 535 (N535D)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
Predicted Effect probably benign
Transcript: ENSMUST00000102703
AA Change: N535D

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: N535D

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132394
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R4957:Zfp39 UTSW 11 58891231 missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58900589 missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R6968:Zfp39 UTSW 11 58891480 missense probably benign 0.00
R7045:Zfp39 UTSW 11 58890443 missense unknown
R7139:Zfp39 UTSW 11 58890559 missense probably damaging 1.00
R7421:Zfp39 UTSW 11 58890107 missense probably damaging 1.00
R7493:Zfp39 UTSW 11 58891043 missense possibly damaging 0.82
R7689:Zfp39 UTSW 11 58890643 missense probably damaging 1.00
R8061:Zfp39 UTSW 11 58902747 missense probably benign
R8136:Zfp39 UTSW 11 58891402 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58890045 nonsense probably null
Z1186:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1186:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1186:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1186:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1186:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1186:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1186:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1186:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58891297 missense probably benign
Z1186:Zfp39 UTSW 11 58891316 missense probably benign
Z1186:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890045 nonsense probably null
Z1187:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1187:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1187:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1187:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1187:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1187:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1187:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1187:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1187:Zfp39 UTSW 11 58891297 missense probably benign
Z1187:Zfp39 UTSW 11 58891316 missense probably benign
Z1187:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890045 nonsense probably null
Z1188:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1188:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1188:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1188:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1188:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1188:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1188:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1188:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1188:Zfp39 UTSW 11 58891297 missense probably benign
Z1188:Zfp39 UTSW 11 58891316 missense probably benign
Z1188:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890045 nonsense probably null
Z1189:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1189:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1189:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1189:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1189:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1189:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1189:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1189:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1189:Zfp39 UTSW 11 58891297 missense probably benign
Z1189:Zfp39 UTSW 11 58891316 missense probably benign
Z1189:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890045 nonsense probably null
Z1190:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1190:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1190:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1190:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1190:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1190:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1190:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1190:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1190:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1190:Zfp39 UTSW 11 58891297 missense probably benign
Z1190:Zfp39 UTSW 11 58891316 missense probably benign
Z1190:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890045 nonsense probably null
Z1191:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1191:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1191:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1191:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1191:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1191:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1191:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1191:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1191:Zfp39 UTSW 11 58891297 missense probably benign
Z1191:Zfp39 UTSW 11 58891316 missense probably benign
Z1191:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890045 nonsense probably null
Z1192:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1192:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1192:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1192:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1192:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1192:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1192:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1192:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1192:Zfp39 UTSW 11 58891297 missense probably benign
Z1192:Zfp39 UTSW 11 58891316 missense probably benign
Z1192:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGTGAAAAGCCTTCTTGC -3'
(R):5'- TACCGCAAGTCACACCTTGG -3'

Sequencing Primer
(F):5'- CTGGTGAAAAGCCTTCTTGCATAGC -3'
(R):5'- CTACTGTAAGTCGGACCTGAATGTC -3'
Posted On2014-10-01