Incidental Mutation 'R2146:Zfp39'
ID 233847
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Name zinc finger protein 39
Synonyms Zfp-39, CTfin33
MMRRC Submission 040149-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R2146 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 58778979-58795051 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58781158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 535 (N535D)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
AlphaFold Q02525
Predicted Effect probably benign
Transcript: ENSMUST00000102703
AA Change: N535D

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: N535D

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132394
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,324,803 (GRCm39) probably null Het
9530002B09Rik T A 4: 122,583,198 (GRCm39) C13* probably null Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Adamts18 G C 8: 114,571,635 (GRCm39) A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap6 A G X: 167,579,496 (GRCm39) T94A probably benign Het
Arhgef5 T C 6: 43,260,252 (GRCm39) S1413P probably damaging Het
Atg4c C A 4: 99,109,463 (GRCm39) N143K possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Cadps2 G T 6: 23,838,998 (GRCm39) probably benign Het
Ccdc185 G T 1: 182,575,085 (GRCm39) H535N possibly damaging Het
Ccdc57 A G 11: 120,776,051 (GRCm39) probably benign Het
Cd163 A G 6: 124,286,167 (GRCm39) H239R probably damaging Het
Ceacam2 G T 7: 25,227,368 (GRCm39) C166* probably null Het
Ces5a T A 8: 94,261,327 (GRCm39) E33D probably benign Het
Chl1 T C 6: 103,692,362 (GRCm39) probably null Het
Chsy3 G A 18: 59,309,544 (GRCm39) V266I probably benign Het
Cpa5 G T 6: 30,626,821 (GRCm39) R251L probably damaging Het
Cps1 A C 1: 67,191,538 (GRCm39) probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cstf1 T C 2: 172,217,683 (GRCm39) Y99H probably damaging Het
Cyp2j11 G A 4: 96,204,595 (GRCm39) T317I probably damaging Het
Dcaf8l T C X: 88,449,883 (GRCm39) D82G possibly damaging Het
Dennd3 C T 15: 73,395,345 (GRCm39) T146M probably damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dnajc22 T C 15: 99,002,264 (GRCm39) V303A probably benign Het
Dtx2 T G 5: 136,059,464 (GRCm39) L458R probably benign Het
Fat3 A T 9: 15,901,808 (GRCm39) F3072L probably benign Het
Fgf5 T C 5: 98,423,409 (GRCm39) *265R probably null Het
Fndc11 A G 2: 180,863,918 (GRCm39) E241G probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gm4922 T G 10: 18,659,264 (GRCm39) Q486P probably benign Het
Gm5786 A T 12: 59,128,084 (GRCm39) noncoding transcript Het
Hepacam2 A T 6: 3,463,378 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,792 (GRCm39) G89R possibly damaging Het
Iqcm T A 8: 76,615,241 (GRCm39) W441R probably damaging Het
Itga10 T C 3: 96,558,808 (GRCm39) L382P possibly damaging Het
Itga10 G T 3: 96,561,039 (GRCm39) G635W probably damaging Het
Kbtbd2 A G 6: 56,756,075 (GRCm39) Y554H probably damaging Het
Kif1b T C 4: 149,268,766 (GRCm39) K1649R probably damaging Het
L1cam A T X: 72,904,747 (GRCm39) F536Y probably damaging Het
Magee1 A T X: 104,166,564 (GRCm39) D783V probably damaging Het
Marveld3 A T 8: 110,686,434 (GRCm39) V144E probably benign Het
Mcam T C 9: 44,047,932 (GRCm39) V59A probably damaging Het
Mdga2 C T 12: 66,915,515 (GRCm39) E47K probably damaging Het
Metrn T A 17: 26,015,601 (GRCm39) E38V probably damaging Het
Mfrp T C 9: 44,015,015 (GRCm39) L314P probably benign Het
Mgat4f T A 1: 134,318,251 (GRCm39) M341K probably damaging Het
Mideas G T 12: 84,219,809 (GRCm39) P382T probably damaging Het
Mospd2 A G X: 163,739,473 (GRCm39) probably null Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myh6 C T 14: 55,191,228 (GRCm39) R871H probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Or13c7b A G 4: 43,821,178 (GRCm39) F61S probably damaging Het
Or5b111 T C 19: 13,291,485 (GRCm39) T55A probably benign Het
Or8i2 T A 2: 86,852,009 (GRCm39) N293I probably damaging Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pdcd11 A G 19: 47,093,191 (GRCm39) M490V probably benign Het
Pkd2 A C 5: 104,603,456 (GRCm39) probably benign Het
Reps1 T A 10: 17,969,061 (GRCm39) D206E probably benign Het
Rimkla T A 4: 119,331,779 (GRCm39) M140L possibly damaging Het
Rnf13 T G 3: 57,709,907 (GRCm39) I150S probably null Het
Rxfp4 C T 3: 88,560,200 (GRCm39) A84T probably damaging Het
Serpinb8 T A 1: 107,533,657 (GRCm39) D237E probably benign Het
Sgo2b T G 8: 64,381,057 (GRCm39) T592P probably benign Het
Slc35d1 A T 4: 103,062,349 (GRCm39) I228N probably damaging Het
Slc39a1 T G 3: 90,156,757 (GRCm39) H104Q probably benign Het
Slc6a6 T C 6: 91,712,161 (GRCm39) V230A probably benign Het
Slc9a3 A G 13: 74,269,722 (GRCm39) E30G probably benign Het
Slc9c1 A G 16: 45,413,827 (GRCm39) Y985C probably benign Het
Supt6 A G 11: 78,121,758 (GRCm39) F298S probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Thoc2l T C 5: 104,666,857 (GRCm39) F460L probably benign Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tnpo3 A G 6: 29,589,035 (GRCm39) V105A probably benign Het
Ttc7 T C 17: 87,654,135 (GRCm39) probably benign Het
Ttn T C 2: 76,727,532 (GRCm39) probably benign Het
Usp16 T C 16: 87,270,075 (GRCm39) probably null Het
Usp36 A G 11: 118,159,491 (GRCm39) L486S probably benign Het
Uty T C Y: 1,239,816 (GRCm39) I72V probably benign Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Zfp160 A G 17: 21,247,244 (GRCm39) K598R probably benign Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58,783,885 (GRCm39) splice site probably benign
IGL01597:Zfp39 APN 11 58,782,369 (GRCm39) missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58,782,156 (GRCm39) missense probably benign
IGL02456:Zfp39 APN 11 58,793,626 (GRCm39) nonsense probably null
IGL02873:Zfp39 APN 11 58,781,848 (GRCm39) missense probably benign 0.12
H8562:Zfp39 UTSW 11 58,791,512 (GRCm39) missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58,781,232 (GRCm39) missense probably benign 0.03
R0513:Zfp39 UTSW 11 58,780,813 (GRCm39) missense probably benign 0.09
R1185:Zfp39 UTSW 11 58,793,670 (GRCm39) missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58,793,670 (GRCm39) missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58,793,670 (GRCm39) missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58,781,149 (GRCm39) missense probably benign 0.01
R1797:Zfp39 UTSW 11 58,791,486 (GRCm39) missense probably damaging 0.96
R3903:Zfp39 UTSW 11 58,781,001 (GRCm39) missense probably benign 0.44
R4303:Zfp39 UTSW 11 58,780,843 (GRCm39) missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58,793,633 (GRCm39) missense probably benign 0.41
R4957:Zfp39 UTSW 11 58,782,057 (GRCm39) missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58,782,028 (GRCm39) missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58,780,671 (GRCm39) missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58,791,415 (GRCm39) missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58,780,661 (GRCm39) missense probably benign 0.08
R5906:Zfp39 UTSW 11 58,793,717 (GRCm39) missense probably benign
R5925:Zfp39 UTSW 11 58,782,099 (GRCm39) missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58,782,213 (GRCm39) missense probably benign 0.01
R6177:Zfp39 UTSW 11 58,781,887 (GRCm39) missense probably benign 0.27
R6968:Zfp39 UTSW 11 58,782,306 (GRCm39) missense probably benign 0.00
R7045:Zfp39 UTSW 11 58,781,269 (GRCm39) missense unknown
R7139:Zfp39 UTSW 11 58,781,385 (GRCm39) missense probably damaging 1.00
R7421:Zfp39 UTSW 11 58,780,933 (GRCm39) missense probably damaging 1.00
R7493:Zfp39 UTSW 11 58,781,869 (GRCm39) missense possibly damaging 0.82
R7689:Zfp39 UTSW 11 58,781,469 (GRCm39) missense probably damaging 1.00
R8061:Zfp39 UTSW 11 58,793,573 (GRCm39) missense probably benign
R8136:Zfp39 UTSW 11 58,782,228 (GRCm39) missense probably damaging 0.99
R8955:Zfp39 UTSW 11 58,780,946 (GRCm39) nonsense probably null
Z1186:Zfp39 UTSW 11 58,781,724 (GRCm39) missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1186:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1186:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1186:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1186:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1186:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1186:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1186:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1186:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1186:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1187:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1187:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1187:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1187:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1187:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1187:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1187:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1187:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1187:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1187:Zfp39 UTSW 11 58,781,724 (GRCm39) missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58,781,712 (GRCm39) missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58,781,702 (GRCm39) missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1188:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1188:Zfp39 UTSW 11 58,781,724 (GRCm39) missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58,781,712 (GRCm39) missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58,781,702 (GRCm39) missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1188:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1188:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1188:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1188:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1188:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1188:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1188:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1188:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1189:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1189:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1189:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1189:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1189:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1189:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1189:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1189:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1189:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1189:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1189:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1190:Zfp39 UTSW 11 58,781,702 (GRCm39) missense probably damaging 0.97
Z1190:Zfp39 UTSW 11 58,781,724 (GRCm39) missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1190:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1190:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1190:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1190:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1190:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1190:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1190:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1190:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1190:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1190:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1191:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1191:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1191:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1191:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1191:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1191:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1191:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1191:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1191:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1191:Zfp39 UTSW 11 58,781,724 (GRCm39) missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58,781,712 (GRCm39) missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58,781,702 (GRCm39) missense probably damaging 0.97
Z1192:Zfp39 UTSW 11 58,781,605 (GRCm39) missense probably benign 0.09
Z1192:Zfp39 UTSW 11 58,781,597 (GRCm39) missense probably benign 0.00
Z1192:Zfp39 UTSW 11 58,781,526 (GRCm39) missense possibly damaging 0.50
Z1192:Zfp39 UTSW 11 58,781,274 (GRCm39) missense possibly damaging 0.86
Z1192:Zfp39 UTSW 11 58,781,273 (GRCm39) missense probably benign 0.16
Z1192:Zfp39 UTSW 11 58,781,130 (GRCm39) missense possibly damaging 0.91
Z1192:Zfp39 UTSW 11 58,780,873 (GRCm39) missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58,780,871 (GRCm39) nonsense probably null
Z1192:Zfp39 UTSW 11 58,791,409 (GRCm39) missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58,791,407 (GRCm39) missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58,782,142 (GRCm39) missense probably benign
Z1192:Zfp39 UTSW 11 58,782,123 (GRCm39) missense probably benign
Z1192:Zfp39 UTSW 11 58,781,967 (GRCm39) missense probably damaging 0.99
Z1192:Zfp39 UTSW 11 58,781,751 (GRCm39) missense probably benign 0.29
Z1192:Zfp39 UTSW 11 58,781,724 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGTGAAAAGCCTTCTTGC -3'
(R):5'- TACCGCAAGTCACACCTTGG -3'

Sequencing Primer
(F):5'- CTGGTGAAAAGCCTTCTTGCATAGC -3'
(R):5'- CTACTGTAAGTCGGACCTGAATGTC -3'
Posted On 2014-10-01