Incidental Mutation 'R2146:Tada2a'
ID233851
Institutional Source Beutler Lab
Gene Symbol Tada2a
Ensembl Gene ENSMUSG00000018651
Gene Nametranscriptional adaptor 2A
SynonymsTada2l, D030022J10Rik
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R2146 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84078920-84129600 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84079629 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 432 (D432G)
Ref Sequence ENSEMBL: ENSMUSP00000018795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018795] [ENSMUST00000141852]
PDB Structure
Structural and functional analysis of ada2 alpha swirm domain [SOLUTION NMR]
Structural and functional analysis of ADA2 alpha swirm domain [SOLUTION NMR]
Solution structure of SWIRM domain of mouse transcriptional adaptor 2-like [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000018795
AA Change: D432G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018795
Gene: ENSMUSG00000018651
AA Change: D432G

DomainStartEndE-ValueType
Blast:ZnF_ZZ 11 57 2e-25 BLAST
SANT 71 120 3.1e-10 SMART
low complexity region 134 143 N/A INTRINSIC
Pfam:SWIRM 364 441 5.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125566
Predicted Effect probably benign
Transcript: ENSMUST00000141852
SMART Domains Protein: ENSMUSP00000119022
Gene: ENSMUSG00000018651

DomainStartEndE-ValueType
Pfam:SWIRM 168 235 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156151
Meta Mutation Damage Score 0.6381 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Tada2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Tada2a APN 11 84087192 splice site probably benign
PIT4131001:Tada2a UTSW 11 84079737 missense probably damaging 0.98
R1438:Tada2a UTSW 11 84110011 missense probably damaging 0.99
R1615:Tada2a UTSW 11 84103100 missense probably damaging 1.00
R1688:Tada2a UTSW 11 84084759 critical splice acceptor site probably null
R1693:Tada2a UTSW 11 84082069 missense probably damaging 1.00
R2147:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2150:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R3980:Tada2a UTSW 11 84103120 missense probably benign 0.41
R5364:Tada2a UTSW 11 84121147 missense probably benign
R5686:Tada2a UTSW 11 84079602 missense possibly damaging 0.59
R7117:Tada2a UTSW 11 84085688 missense probably damaging 0.99
R7439:Tada2a UTSW 11 84126986 critical splice donor site probably null
Z1177:Tada2a UTSW 11 84093667 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGACGCACTATCCTGAC -3'
(R):5'- ACCTGCTGGATGAATTTGTGAG -3'

Sequencing Primer
(F):5'- GCAGCGCTTTACAGAGGG -3'
(R):5'- TGTGAGAATGACAGTGCTAATTACG -3'
Posted On2014-10-01