Incidental Mutation 'R2146:Dnajc22'
ID 233865
Institutional Source Beutler Lab
Gene Symbol Dnajc22
Ensembl Gene ENSMUSG00000038009
Gene Name DnaJ heat shock protein family (Hsp40) member C22
Synonyms 2810451A06Rik
MMRRC Submission 040149-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2146 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 98991102-99002618 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99002264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000055482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061295]
AlphaFold Q8CHS2
Predicted Effect probably benign
Transcript: ENSMUST00000061295
AA Change: V303A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055482
Gene: ENSMUSG00000038009
AA Change: V303A

DomainStartEndE-ValueType
Pfam:TM2 1 50 1e-10 PFAM
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
DnaJ 276 335 1.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146173
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,324,803 (GRCm39) probably null Het
9530002B09Rik T A 4: 122,583,198 (GRCm39) C13* probably null Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Adamts18 G C 8: 114,571,635 (GRCm39) A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap6 A G X: 167,579,496 (GRCm39) T94A probably benign Het
Arhgef5 T C 6: 43,260,252 (GRCm39) S1413P probably damaging Het
Atg4c C A 4: 99,109,463 (GRCm39) N143K possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Cadps2 G T 6: 23,838,998 (GRCm39) probably benign Het
Ccdc185 G T 1: 182,575,085 (GRCm39) H535N possibly damaging Het
Ccdc57 A G 11: 120,776,051 (GRCm39) probably benign Het
Cd163 A G 6: 124,286,167 (GRCm39) H239R probably damaging Het
Ceacam2 G T 7: 25,227,368 (GRCm39) C166* probably null Het
Ces5a T A 8: 94,261,327 (GRCm39) E33D probably benign Het
Chl1 T C 6: 103,692,362 (GRCm39) probably null Het
Chsy3 G A 18: 59,309,544 (GRCm39) V266I probably benign Het
Cpa5 G T 6: 30,626,821 (GRCm39) R251L probably damaging Het
Cps1 A C 1: 67,191,538 (GRCm39) probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cstf1 T C 2: 172,217,683 (GRCm39) Y99H probably damaging Het
Cyp2j11 G A 4: 96,204,595 (GRCm39) T317I probably damaging Het
Dcaf8l T C X: 88,449,883 (GRCm39) D82G possibly damaging Het
Dennd3 C T 15: 73,395,345 (GRCm39) T146M probably damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dtx2 T G 5: 136,059,464 (GRCm39) L458R probably benign Het
Fat3 A T 9: 15,901,808 (GRCm39) F3072L probably benign Het
Fgf5 T C 5: 98,423,409 (GRCm39) *265R probably null Het
Fndc11 A G 2: 180,863,918 (GRCm39) E241G probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gm4922 T G 10: 18,659,264 (GRCm39) Q486P probably benign Het
Gm5786 A T 12: 59,128,084 (GRCm39) noncoding transcript Het
Hepacam2 A T 6: 3,463,378 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,792 (GRCm39) G89R possibly damaging Het
Iqcm T A 8: 76,615,241 (GRCm39) W441R probably damaging Het
Itga10 T C 3: 96,558,808 (GRCm39) L382P possibly damaging Het
Itga10 G T 3: 96,561,039 (GRCm39) G635W probably damaging Het
Kbtbd2 A G 6: 56,756,075 (GRCm39) Y554H probably damaging Het
Kif1b T C 4: 149,268,766 (GRCm39) K1649R probably damaging Het
L1cam A T X: 72,904,747 (GRCm39) F536Y probably damaging Het
Magee1 A T X: 104,166,564 (GRCm39) D783V probably damaging Het
Marveld3 A T 8: 110,686,434 (GRCm39) V144E probably benign Het
Mcam T C 9: 44,047,932 (GRCm39) V59A probably damaging Het
Mdga2 C T 12: 66,915,515 (GRCm39) E47K probably damaging Het
Metrn T A 17: 26,015,601 (GRCm39) E38V probably damaging Het
Mfrp T C 9: 44,015,015 (GRCm39) L314P probably benign Het
Mgat4f T A 1: 134,318,251 (GRCm39) M341K probably damaging Het
Mideas G T 12: 84,219,809 (GRCm39) P382T probably damaging Het
Mospd2 A G X: 163,739,473 (GRCm39) probably null Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myh6 C T 14: 55,191,228 (GRCm39) R871H probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Or13c7b A G 4: 43,821,178 (GRCm39) F61S probably damaging Het
Or5b111 T C 19: 13,291,485 (GRCm39) T55A probably benign Het
Or8i2 T A 2: 86,852,009 (GRCm39) N293I probably damaging Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pdcd11 A G 19: 47,093,191 (GRCm39) M490V probably benign Het
Pkd2 A C 5: 104,603,456 (GRCm39) probably benign Het
Reps1 T A 10: 17,969,061 (GRCm39) D206E probably benign Het
Rimkla T A 4: 119,331,779 (GRCm39) M140L possibly damaging Het
Rnf13 T G 3: 57,709,907 (GRCm39) I150S probably null Het
Rxfp4 C T 3: 88,560,200 (GRCm39) A84T probably damaging Het
Serpinb8 T A 1: 107,533,657 (GRCm39) D237E probably benign Het
Sgo2b T G 8: 64,381,057 (GRCm39) T592P probably benign Het
Slc35d1 A T 4: 103,062,349 (GRCm39) I228N probably damaging Het
Slc39a1 T G 3: 90,156,757 (GRCm39) H104Q probably benign Het
Slc6a6 T C 6: 91,712,161 (GRCm39) V230A probably benign Het
Slc9a3 A G 13: 74,269,722 (GRCm39) E30G probably benign Het
Slc9c1 A G 16: 45,413,827 (GRCm39) Y985C probably benign Het
Supt6 A G 11: 78,121,758 (GRCm39) F298S probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Thoc2l T C 5: 104,666,857 (GRCm39) F460L probably benign Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tnpo3 A G 6: 29,589,035 (GRCm39) V105A probably benign Het
Ttc7 T C 17: 87,654,135 (GRCm39) probably benign Het
Ttn T C 2: 76,727,532 (GRCm39) probably benign Het
Usp16 T C 16: 87,270,075 (GRCm39) probably null Het
Usp36 A G 11: 118,159,491 (GRCm39) L486S probably benign Het
Uty T C Y: 1,239,816 (GRCm39) I72V probably benign Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Zfp160 A G 17: 21,247,244 (GRCm39) K598R probably benign Het
Zfp39 T C 11: 58,781,158 (GRCm39) N535D probably benign Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Dnajc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dnajc22 APN 15 98,999,059 (GRCm39) missense possibly damaging 0.73
IGL00922:Dnajc22 APN 15 98,999,460 (GRCm39) missense possibly damaging 0.89
IGL02155:Dnajc22 APN 15 98,998,886 (GRCm39) missense probably damaging 1.00
IGL02726:Dnajc22 APN 15 98,998,881 (GRCm39) missense probably damaging 1.00
IGL03074:Dnajc22 APN 15 98,999,403 (GRCm39) missense probably damaging 1.00
F5770:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
R1138:Dnajc22 UTSW 15 99,002,308 (GRCm39) small deletion probably benign
R1628:Dnajc22 UTSW 15 98,998,817 (GRCm39) start codon destroyed probably null 1.00
R2018:Dnajc22 UTSW 15 98,999,114 (GRCm39) missense probably benign 0.06
R4342:Dnajc22 UTSW 15 99,002,345 (GRCm39) nonsense probably null
R4950:Dnajc22 UTSW 15 98,999,615 (GRCm39) missense probably benign 0.29
R7123:Dnajc22 UTSW 15 98,999,085 (GRCm39) missense possibly damaging 0.89
R7173:Dnajc22 UTSW 15 98,999,187 (GRCm39) missense probably benign 0.06
R7640:Dnajc22 UTSW 15 98,998,995 (GRCm39) missense probably damaging 1.00
R7997:Dnajc22 UTSW 15 98,999,514 (GRCm39) missense probably damaging 1.00
R8338:Dnajc22 UTSW 15 98,999,022 (GRCm39) missense probably benign 0.00
R8745:Dnajc22 UTSW 15 98,999,345 (GRCm39) missense probably benign 0.01
V7580:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
V7581:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
V7582:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
V7583:Dnajc22 UTSW 15 98,999,363 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAATGAAGTTCTGTCTGAGGC -3'
(R):5'- GCTGCCAGCAGTTTCTTTAAC -3'

Sequencing Primer
(F):5'- CTCTGGGCCATTCTAGTTCTAAGGAG -3'
(R):5'- CTTTAACTGTCAGGTCCTGGG -3'
Posted On 2014-10-01