Incidental Mutation 'R2146:Pdcd11'
ID 233874
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Name programmed cell death 11
Synonyms ALG-4, 1110021I22Rik
MMRRC Submission 040149-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R2146 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 47079183-47119585 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 47093191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 490 (M490V)
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072141] [ENSMUST00000140512]
AlphaFold Q6NS46
Predicted Effect probably benign
Transcript: ENSMUST00000072141
AA Change: M490V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047
AA Change: M490V

DomainStartEndE-ValueType
low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,324,803 (GRCm39) probably null Het
9530002B09Rik T A 4: 122,583,198 (GRCm39) C13* probably null Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Adamts18 G C 8: 114,571,635 (GRCm39) A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arhgap6 A G X: 167,579,496 (GRCm39) T94A probably benign Het
Arhgef5 T C 6: 43,260,252 (GRCm39) S1413P probably damaging Het
Atg4c C A 4: 99,109,463 (GRCm39) N143K possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Cadps2 G T 6: 23,838,998 (GRCm39) probably benign Het
Ccdc185 G T 1: 182,575,085 (GRCm39) H535N possibly damaging Het
Ccdc57 A G 11: 120,776,051 (GRCm39) probably benign Het
Cd163 A G 6: 124,286,167 (GRCm39) H239R probably damaging Het
Ceacam2 G T 7: 25,227,368 (GRCm39) C166* probably null Het
Ces5a T A 8: 94,261,327 (GRCm39) E33D probably benign Het
Chl1 T C 6: 103,692,362 (GRCm39) probably null Het
Chsy3 G A 18: 59,309,544 (GRCm39) V266I probably benign Het
Cpa5 G T 6: 30,626,821 (GRCm39) R251L probably damaging Het
Cps1 A C 1: 67,191,538 (GRCm39) probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cstf1 T C 2: 172,217,683 (GRCm39) Y99H probably damaging Het
Cyp2j11 G A 4: 96,204,595 (GRCm39) T317I probably damaging Het
Dcaf8l T C X: 88,449,883 (GRCm39) D82G possibly damaging Het
Dennd3 C T 15: 73,395,345 (GRCm39) T146M probably damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dnajc22 T C 15: 99,002,264 (GRCm39) V303A probably benign Het
Dtx2 T G 5: 136,059,464 (GRCm39) L458R probably benign Het
Fat3 A T 9: 15,901,808 (GRCm39) F3072L probably benign Het
Fgf5 T C 5: 98,423,409 (GRCm39) *265R probably null Het
Fndc11 A G 2: 180,863,918 (GRCm39) E241G probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gm4922 T G 10: 18,659,264 (GRCm39) Q486P probably benign Het
Gm5786 A T 12: 59,128,084 (GRCm39) noncoding transcript Het
Hepacam2 A T 6: 3,463,378 (GRCm39) probably benign Het
Ints9 G A 14: 65,223,792 (GRCm39) G89R possibly damaging Het
Iqcm T A 8: 76,615,241 (GRCm39) W441R probably damaging Het
Itga10 T C 3: 96,558,808 (GRCm39) L382P possibly damaging Het
Itga10 G T 3: 96,561,039 (GRCm39) G635W probably damaging Het
Kbtbd2 A G 6: 56,756,075 (GRCm39) Y554H probably damaging Het
Kif1b T C 4: 149,268,766 (GRCm39) K1649R probably damaging Het
L1cam A T X: 72,904,747 (GRCm39) F536Y probably damaging Het
Magee1 A T X: 104,166,564 (GRCm39) D783V probably damaging Het
Marveld3 A T 8: 110,686,434 (GRCm39) V144E probably benign Het
Mcam T C 9: 44,047,932 (GRCm39) V59A probably damaging Het
Mdga2 C T 12: 66,915,515 (GRCm39) E47K probably damaging Het
Metrn T A 17: 26,015,601 (GRCm39) E38V probably damaging Het
Mfrp T C 9: 44,015,015 (GRCm39) L314P probably benign Het
Mgat4f T A 1: 134,318,251 (GRCm39) M341K probably damaging Het
Mideas G T 12: 84,219,809 (GRCm39) P382T probably damaging Het
Mospd2 A G X: 163,739,473 (GRCm39) probably null Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myh6 C T 14: 55,191,228 (GRCm39) R871H probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Or13c7b A G 4: 43,821,178 (GRCm39) F61S probably damaging Het
Or5b111 T C 19: 13,291,485 (GRCm39) T55A probably benign Het
Or8i2 T A 2: 86,852,009 (GRCm39) N293I probably damaging Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pkd2 A C 5: 104,603,456 (GRCm39) probably benign Het
Reps1 T A 10: 17,969,061 (GRCm39) D206E probably benign Het
Rimkla T A 4: 119,331,779 (GRCm39) M140L possibly damaging Het
Rnf13 T G 3: 57,709,907 (GRCm39) I150S probably null Het
Rxfp4 C T 3: 88,560,200 (GRCm39) A84T probably damaging Het
Serpinb8 T A 1: 107,533,657 (GRCm39) D237E probably benign Het
Sgo2b T G 8: 64,381,057 (GRCm39) T592P probably benign Het
Slc35d1 A T 4: 103,062,349 (GRCm39) I228N probably damaging Het
Slc39a1 T G 3: 90,156,757 (GRCm39) H104Q probably benign Het
Slc6a6 T C 6: 91,712,161 (GRCm39) V230A probably benign Het
Slc9a3 A G 13: 74,269,722 (GRCm39) E30G probably benign Het
Slc9c1 A G 16: 45,413,827 (GRCm39) Y985C probably benign Het
Supt6 A G 11: 78,121,758 (GRCm39) F298S probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Thoc2l T C 5: 104,666,857 (GRCm39) F460L probably benign Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tnpo3 A G 6: 29,589,035 (GRCm39) V105A probably benign Het
Ttc7 T C 17: 87,654,135 (GRCm39) probably benign Het
Ttn T C 2: 76,727,532 (GRCm39) probably benign Het
Usp16 T C 16: 87,270,075 (GRCm39) probably null Het
Usp36 A G 11: 118,159,491 (GRCm39) L486S probably benign Het
Uty T C Y: 1,239,816 (GRCm39) I72V probably benign Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Zfp160 A G 17: 21,247,244 (GRCm39) K598R probably benign Het
Zfp39 T C 11: 58,781,158 (GRCm39) N535D probably benign Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47,105,767 (GRCm39) missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47,086,609 (GRCm39) missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47,092,221 (GRCm39) missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47,096,003 (GRCm39) missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47,102,989 (GRCm39) intron probably benign
IGL01346:Pdcd11 APN 19 47,098,053 (GRCm39) missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47,098,068 (GRCm39) missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47,094,743 (GRCm39) missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47,089,604 (GRCm39) missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47,094,860 (GRCm39) missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47,115,381 (GRCm39) missense probably benign
IGL02515:Pdcd11 APN 19 47,113,516 (GRCm39) missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47,102,064 (GRCm39) missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47,116,500 (GRCm39) missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47,091,105 (GRCm39) missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47,091,105 (GRCm39) missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47,108,301 (GRCm39) missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47,099,398 (GRCm39) critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47,101,876 (GRCm39) intron probably benign
R0316:Pdcd11 UTSW 19 47,101,611 (GRCm39) missense probably damaging 0.97
R0480:Pdcd11 UTSW 19 47,113,476 (GRCm39) intron probably benign
R0577:Pdcd11 UTSW 19 47,087,271 (GRCm39) missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47,115,730 (GRCm39) missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47,118,516 (GRCm39) missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47,118,516 (GRCm39) missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47,086,626 (GRCm39) missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47,093,191 (GRCm39) missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47,102,995 (GRCm39) missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47,101,876 (GRCm39) intron probably benign
R3177:Pdcd11 UTSW 19 47,101,703 (GRCm39) missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47,101,703 (GRCm39) missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47,115,684 (GRCm39) intron probably benign
R4495:Pdcd11 UTSW 19 47,099,445 (GRCm39) missense probably benign
R4697:Pdcd11 UTSW 19 47,114,786 (GRCm39) missense possibly damaging 0.83
R4941:Pdcd11 UTSW 19 47,108,325 (GRCm39) missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47,116,404 (GRCm39) missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47,095,554 (GRCm39) missense probably benign
R5049:Pdcd11 UTSW 19 47,095,554 (GRCm39) missense probably benign
R5103:Pdcd11 UTSW 19 47,112,893 (GRCm39) missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47,094,893 (GRCm39) missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47,095,554 (GRCm39) missense probably benign
R5261:Pdcd11 UTSW 19 47,101,976 (GRCm39) missense probably benign
R5302:Pdcd11 UTSW 19 47,096,083 (GRCm39) missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47,091,164 (GRCm39) missense probably benign
R5769:Pdcd11 UTSW 19 47,091,076 (GRCm39) missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47,099,430 (GRCm39) missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47,082,247 (GRCm39) missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47,093,198 (GRCm39) missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47,116,771 (GRCm39) missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47,117,702 (GRCm39) missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47,108,722 (GRCm39) missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47,098,191 (GRCm39) missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47,098,117 (GRCm39) missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47,099,520 (GRCm39) missense probably benign 0.11
R7009:Pdcd11 UTSW 19 47,101,581 (GRCm39) missense probably benign 0.17
R7015:Pdcd11 UTSW 19 47,086,665 (GRCm39) missense probably benign 0.00
R7060:Pdcd11 UTSW 19 47,099,418 (GRCm39) missense probably benign 0.30
R7260:Pdcd11 UTSW 19 47,117,673 (GRCm39) missense possibly damaging 0.62
R7392:Pdcd11 UTSW 19 47,116,436 (GRCm39) missense probably damaging 1.00
R7601:Pdcd11 UTSW 19 47,094,808 (GRCm39) missense not run
R7759:Pdcd11 UTSW 19 47,101,637 (GRCm39) missense possibly damaging 0.88
R7760:Pdcd11 UTSW 19 47,101,637 (GRCm39) missense possibly damaging 0.88
R7785:Pdcd11 UTSW 19 47,093,125 (GRCm39) missense probably benign 0.00
R7793:Pdcd11 UTSW 19 47,094,871 (GRCm39) missense probably benign 0.00
R7810:Pdcd11 UTSW 19 47,086,659 (GRCm39) missense possibly damaging 0.81
R7863:Pdcd11 UTSW 19 47,085,403 (GRCm39) missense probably damaging 1.00
R7950:Pdcd11 UTSW 19 47,101,876 (GRCm39) intron probably benign
R8062:Pdcd11 UTSW 19 47,119,152 (GRCm39) missense possibly damaging 0.50
R8184:Pdcd11 UTSW 19 47,101,791 (GRCm39) nonsense probably null
R8278:Pdcd11 UTSW 19 47,094,736 (GRCm39) missense probably damaging 1.00
R8404:Pdcd11 UTSW 19 47,093,231 (GRCm39) missense probably damaging 0.98
R8508:Pdcd11 UTSW 19 47,108,245 (GRCm39) missense probably damaging 1.00
R8525:Pdcd11 UTSW 19 47,081,337 (GRCm39) missense possibly damaging 0.52
R8787:Pdcd11 UTSW 19 47,097,019 (GRCm39) missense probably damaging 1.00
R9019:Pdcd11 UTSW 19 47,101,658 (GRCm39) missense probably damaging 1.00
R9534:Pdcd11 UTSW 19 47,108,718 (GRCm39) missense probably benign 0.01
R9660:Pdcd11 UTSW 19 47,082,191 (GRCm39) missense possibly damaging 0.67
R9712:Pdcd11 UTSW 19 47,117,741 (GRCm39) missense probably damaging 0.98
RF010:Pdcd11 UTSW 19 47,101,890 (GRCm39) frame shift probably null
RF027:Pdcd11 UTSW 19 47,101,888 (GRCm39) frame shift probably null
RF039:Pdcd11 UTSW 19 47,101,894 (GRCm39) frame shift probably null
RF061:Pdcd11 UTSW 19 47,101,884 (GRCm39) frame shift probably null
X0065:Pdcd11 UTSW 19 47,085,335 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATAGCCAGGCTACGTC -3'
(R):5'- CTTCCCACTGCTAGGTGAAGTAC -3'

Sequencing Primer
(F):5'- TGGCTTTCCCACATGAGATC -3'
(R):5'- CCACTGCTAGGTGAAGTACTGAATAC -3'
Posted On 2014-10-01