Incidental Mutation 'R2146:L1cam'
ID233875
Institutional Source Beutler Lab
Gene Symbol L1cam
Ensembl Gene ENSMUSG00000031391
Gene NameL1 cell adhesion molecule
SynonymsCD171, L1-NCAM, NCAM-L1, L1
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2146 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location73853778-73896105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73861141 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 536 (F536Y)
Ref Sequence ENSEMBL: ENSMUSP00000110073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066576] [ENSMUST00000102871] [ENSMUST00000114430] [ENSMUST00000146790]
Predicted Effect probably damaging
Transcript: ENSMUST00000066576
AA Change: F531Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068135
Gene: ENSMUSG00000031391
AA Change: F531Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 43 115 3.59e-5 SMART
IG 137 224 2.66e-8 SMART
IGc2 249 313 1.25e-22 SMART
IGc2 339 405 1.06e-7 SMART
IGc2 433 498 6.55e-8 SMART
IGc2 524 592 1.19e-5 SMART
FN3 606 692 3.76e-6 SMART
FN3 709 791 1.31e-5 SMART
FN3 807 898 5.78e-7 SMART
FN3 912 996 1.51e-10 SMART
Blast:FN3 1010 1093 8e-36 BLAST
transmembrane domain 1118 1140 N/A INTRINSIC
Pfam:Bravo_FIGEY 1141 1228 6.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102871
AA Change: F536Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099935
Gene: ENSMUSG00000031391
AA Change: F536Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 48 120 3.59e-5 SMART
IG 142 229 2.66e-8 SMART
IGc2 254 318 1.25e-22 SMART
IGc2 344 410 1.06e-7 SMART
IGc2 438 503 6.55e-8 SMART
IGc2 529 597 1.19e-5 SMART
FN3 611 697 3.76e-6 SMART
FN3 714 796 1.31e-5 SMART
FN3 812 903 5.78e-7 SMART
FN3 917 1001 1.51e-10 SMART
Blast:FN3 1015 1098 9e-36 BLAST
transmembrane domain 1123 1145 N/A INTRINSIC
Pfam:Bravo_FIGEY 1146 1235 8.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114430
AA Change: F536Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110073
Gene: ENSMUSG00000031391
AA Change: F536Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 48 120 3.59e-5 SMART
IG 142 229 2.66e-8 SMART
IGc2 254 318 1.25e-22 SMART
IGc2 344 410 1.06e-7 SMART
IGc2 438 503 6.55e-8 SMART
IGc2 529 597 1.19e-5 SMART
FN3 611 697 3.76e-6 SMART
FN3 714 796 1.31e-5 SMART
FN3 812 903 5.78e-7 SMART
FN3 917 1001 1.51e-10 SMART
Blast:FN3 1015 1098 9e-36 BLAST
transmembrane domain 1123 1145 N/A INTRINSIC
Pfam:Bravo_FIGEY 1146 1233 6.7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124560
SMART Domains Protein: ENSMUSP00000115923
Gene: ENSMUSG00000031391

DomainStartEndE-ValueType
Blast:FN3 2 34 2e-11 BLAST
Pfam:Bravo_FIGEY 42 121 9.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145805
Predicted Effect probably benign
Transcript: ENSMUST00000146790
SMART Domains Protein: ENSMUSP00000121797
Gene: ENSMUSG00000031391

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Ig_2 34 82 3.8e-7 PFAM
Pfam:I-set 35 84 1.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148250
SMART Domains Protein: ENSMUSP00000114609
Gene: ENSMUSG00000031391

DomainStartEndE-ValueType
IG 2 67 3.18e0 SMART
Pfam:fn3 137 190 6.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155246
Meta Mutation Damage Score 0.6809 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an axonal glycoprotein belonging to the immunoglobulin supergene family. The ectodomain, consisting of several immunoglobulin-like domains and fibronectin-like repeats (type III), is linked via a single transmembrane sequence to a conserved cytoplasmic domain. This cell adhesion molecule plays an important role in nervous system development, including neuronal migration and differentiation. Mutations in the gene cause X-linked neurological syndromes known as CRASH (corpus callosum hypoplasia, retardation, aphasia, spastic paraplegia and hydrocephalus). Alternative splicing of this gene results in multiple transcript variants, some of which include an alternate exon that is considered to be specific to neurons. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous null mutants have reduced size, lessened sensitivity to touch and pain, weakness and incoordination of hind-legs, reduced corticospinal tract, impaired guidance of retinal and corticospinal axons, and in some cases, enlarged lateral ventricles. A hypomorphic line shows background effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in L1cam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:L1cam APN X 73864438 missense probably damaging 1.00
IGL02074:L1cam APN X 73863013 missense probably damaging 1.00
IGL03059:L1cam APN X 73867024 missense probably benign 0.01
IGL03351:L1cam APN X 73863028 missense probably damaging 1.00
R0079:L1cam UTSW X 73869758 missense probably damaging 0.99
R2148:L1cam UTSW X 73861141 missense probably damaging 1.00
R2231:L1cam UTSW X 73861341 missense possibly damaging 0.95
R2232:L1cam UTSW X 73861341 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAAGGCTAGGAGGTCTGACTC -3'
(R):5'- TTTCTGCCAGGCTGCCAATG -3'

Sequencing Primer
(F):5'- GAGGTCTGACTCCCAAATTTTCTCAC -3'
(R):5'- GTGACCATTTTGGCTAACCTACAGG -3'
Posted On2014-10-01