Incidental Mutation 'R2147:Vmn2r-ps159'
ID233899
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R2147 (G1)
Quality Score191
Status Not validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 156334719 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cep57l1 A G 10: 41,740,899 Y131H probably damaging Het
Cfap44 A G 16: 44,451,684 R1267G probably benign Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pank1 T C 19: 34,827,354 H134R probably benign Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Skint8 C G 4: 111,937,077 N221K probably damaging Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2510:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2899:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3106:Vmn2r-ps159 UTSW 4 156333435 intron noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5144:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5271:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
R5775:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CTTGGAATGGACATCACTGCAC -3'
(R):5'- GTTGAGACACCTTTTCACAAAACTC -3'

Sequencing Primer
(F):5'- CTGCACAACTATGATATGGCG -3'
(R):5'- CCTTTTCACAAAACTCACTGATATTC -3'
Posted On2014-10-01