Incidental Mutation 'R2147:Cadps2'
ID 233906
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 040150-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2147 (G1)
Quality Score 91
Status Not validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to T at 23838998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000163871] [ENSMUST00000142913] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000018122
AA Change: R47S
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000069074
AA Change: R47S
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115355
SMART Domains Protein: ENSMUSP00000111012
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115356
AA Change: R47S
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115358
AA Change: R47S
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115361
AA Change: R47S
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163871
AA Change: R47S
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136279
Predicted Effect probably benign
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 159,903,003 (GRCm39) M91K probably benign Het
Abr T C 11: 76,346,474 (GRCm39) R437G probably damaging Het
Acaca T G 11: 84,167,362 (GRCm39) D1045E probably benign Het
Adam23 A T 1: 63,573,521 (GRCm39) probably null Het
Adam34 A G 8: 44,105,538 (GRCm39) Y36H probably benign Het
Alg11 G A 8: 22,555,309 (GRCm39) G108D probably damaging Het
Alox12e A T 11: 70,210,771 (GRCm39) I316N probably damaging Het
Arid1a A T 4: 133,408,677 (GRCm39) F1943L unknown Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC035044 T C 6: 128,867,867 (GRCm39) probably benign Het
Bcor G A X: 11,923,862 (GRCm39) A578V possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Ccnf A T 17: 24,449,288 (GRCm39) probably null Het
Cdadc1 A G 14: 59,835,202 (GRCm39) probably null Het
Cep57l1 A G 10: 41,616,895 (GRCm39) Y131H probably damaging Het
Cfap251 T C 5: 123,394,254 (GRCm39) V381A probably benign Het
Cfap44 A G 16: 44,272,047 (GRCm39) R1267G probably benign Het
Chd3 A T 11: 69,239,854 (GRCm39) L1658Q probably benign Het
Chl1 T C 6: 103,692,362 (GRCm39) probably null Het
Chpf2 T A 5: 24,797,033 (GRCm39) F660I probably damaging Het
Cmas T A 6: 142,717,015 (GRCm39) D302E probably benign Het
Cpne3 T A 4: 19,536,562 (GRCm39) M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Dennd3 T G 15: 73,395,336 (GRCm39) L143R probably damaging Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ergic1 A G 17: 26,855,024 (GRCm39) probably null Het
Fbxl15 A T 19: 46,317,627 (GRCm39) D103V probably damaging Het
Gm4781 C A 10: 100,232,414 (GRCm39) noncoding transcript Het
Hpca A G 4: 129,012,278 (GRCm39) I86T possibly damaging Het
Katnip T A 7: 125,464,492 (GRCm39) H1286Q probably damaging Het
Lamb3 T C 1: 193,010,212 (GRCm39) V275A probably benign Het
Lipe G T 7: 25,087,946 (GRCm39) A38E probably benign Het
Lrrk1 A T 7: 65,935,159 (GRCm39) probably null Het
Lrsam1 T C 2: 32,835,891 (GRCm39) K292R probably damaging Het
Mbtps1 A T 8: 120,265,598 (GRCm39) H316Q probably benign Het
Mms22l T A 4: 24,580,063 (GRCm39) Y525* probably null Het
Mrps14 T C 1: 160,022,862 (GRCm39) L9P possibly damaging Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myo15a A G 11: 60,401,055 (GRCm39) D2992G possibly damaging Het
N4bp2 T A 5: 65,966,543 (GRCm39) L1327Q probably damaging Het
Nradd A T 9: 110,451,243 (GRCm39) F42I probably benign Het
Or5k8 T A 16: 58,644,842 (GRCm39) I77F probably damaging Het
Pank1 T C 19: 34,804,754 (GRCm39) H134R probably benign Het
Pcdh7 T A 5: 58,286,458 (GRCm39) M1178K possibly damaging Het
Pcnx3 A T 19: 5,717,633 (GRCm39) I1084N probably damaging Het
Pdcd11 A G 19: 47,093,191 (GRCm39) M490V probably benign Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pitpnc1 C T 11: 107,103,344 (GRCm39) A252T probably damaging Het
Prickle2 A G 6: 92,402,652 (GRCm39) L112P probably damaging Het
Prpf8 A G 11: 75,381,357 (GRCm39) I231V probably benign Het
Scin T A 12: 40,130,984 (GRCm39) M310L probably benign Het
Serpina3m T A 12: 104,355,483 (GRCm39) I50N probably benign Het
Skint8 C G 4: 111,794,274 (GRCm39) N221K probably damaging Het
Slc22a23 C T 13: 34,366,990 (GRCm39) V673M probably benign Het
Slc24a5 A G 2: 124,929,361 (GRCm39) D368G probably damaging Het
Slc28a1 A T 7: 80,776,015 (GRCm39) Q237L possibly damaging Het
Smchd1 T A 17: 71,705,583 (GRCm39) K1005N possibly damaging Het
Stim2 T C 5: 54,262,717 (GRCm39) Y320H probably damaging Het
Syne3 T A 12: 104,919,357 (GRCm39) D512V probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Tcp10a T C 17: 7,601,701 (GRCm39) S216P probably damaging Het
Tmem178b A T 6: 40,184,435 (GRCm39) Q111L probably damaging Het
Tmem236 A G 2: 14,223,861 (GRCm39) I217V probably benign Het
Tmem45b A G 9: 31,340,277 (GRCm39) V128A probably benign Het
Tnfaip2 T C 12: 111,412,456 (GRCm39) Y286H probably damaging Het
Tsc2 T A 17: 24,840,116 (GRCm39) I427L possibly damaging Het
Ttc17 T A 2: 94,132,139 (GRCm39) N1180I possibly damaging Het
Ubr1 T G 2: 120,694,811 (GRCm39) D1707A probably damaging Het
Vmn1r11 A G 6: 57,114,583 (GRCm39) I82M probably benign Het
Vmn2r129 T C 4: 156,687,014 (GRCm39) noncoding transcript Het
Vps41 G T 13: 19,023,904 (GRCm39) probably null Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Zfp629 T C 7: 127,209,616 (GRCm39) H731R probably damaging Het
Zfp712 T C 13: 67,189,960 (GRCm39) E189G possibly damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGAATGGGTACGCGATGCAC -3'
(R):5'- AACTCGACGTGTCCGGAAAG -3'

Sequencing Primer
(F):5'- GTACGCGATGCACCTCAC -3'
(R):5'- AAAGCCCGGGCCACTTTC -3'
Posted On 2014-10-01