Incidental Mutation 'R2147:Acaca'
ID 233937
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission 040150-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2147 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 84167362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1045 (D1045E)
Ref Sequence ENSEMBL: ENSMUSP00000099490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
AlphaFold Q5SWU9
Predicted Effect probably benign
Transcript: ENSMUST00000020843
AA Change: D1045E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: D1045E

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103201
AA Change: D1045E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: D1045E

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183887
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 159,903,003 (GRCm39) M91K probably benign Het
Abr T C 11: 76,346,474 (GRCm39) R437G probably damaging Het
Adam23 A T 1: 63,573,521 (GRCm39) probably null Het
Adam34 A G 8: 44,105,538 (GRCm39) Y36H probably benign Het
Alg11 G A 8: 22,555,309 (GRCm39) G108D probably damaging Het
Alox12e A T 11: 70,210,771 (GRCm39) I316N probably damaging Het
Arid1a A T 4: 133,408,677 (GRCm39) F1943L unknown Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC035044 T C 6: 128,867,867 (GRCm39) probably benign Het
Bcor G A X: 11,923,862 (GRCm39) A578V possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Cadps2 G T 6: 23,838,998 (GRCm39) probably benign Het
Ccnf A T 17: 24,449,288 (GRCm39) probably null Het
Cdadc1 A G 14: 59,835,202 (GRCm39) probably null Het
Cep57l1 A G 10: 41,616,895 (GRCm39) Y131H probably damaging Het
Cfap251 T C 5: 123,394,254 (GRCm39) V381A probably benign Het
Cfap44 A G 16: 44,272,047 (GRCm39) R1267G probably benign Het
Chd3 A T 11: 69,239,854 (GRCm39) L1658Q probably benign Het
Chl1 T C 6: 103,692,362 (GRCm39) probably null Het
Chpf2 T A 5: 24,797,033 (GRCm39) F660I probably damaging Het
Cmas T A 6: 142,717,015 (GRCm39) D302E probably benign Het
Cpne3 T A 4: 19,536,562 (GRCm39) M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Dennd3 T G 15: 73,395,336 (GRCm39) L143R probably damaging Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ergic1 A G 17: 26,855,024 (GRCm39) probably null Het
Fbxl15 A T 19: 46,317,627 (GRCm39) D103V probably damaging Het
Gm4781 C A 10: 100,232,414 (GRCm39) noncoding transcript Het
Hpca A G 4: 129,012,278 (GRCm39) I86T possibly damaging Het
Katnip T A 7: 125,464,492 (GRCm39) H1286Q probably damaging Het
Lamb3 T C 1: 193,010,212 (GRCm39) V275A probably benign Het
Lipe G T 7: 25,087,946 (GRCm39) A38E probably benign Het
Lrrk1 A T 7: 65,935,159 (GRCm39) probably null Het
Lrsam1 T C 2: 32,835,891 (GRCm39) K292R probably damaging Het
Mbtps1 A T 8: 120,265,598 (GRCm39) H316Q probably benign Het
Mms22l T A 4: 24,580,063 (GRCm39) Y525* probably null Het
Mrps14 T C 1: 160,022,862 (GRCm39) L9P possibly damaging Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myo15a A G 11: 60,401,055 (GRCm39) D2992G possibly damaging Het
N4bp2 T A 5: 65,966,543 (GRCm39) L1327Q probably damaging Het
Nradd A T 9: 110,451,243 (GRCm39) F42I probably benign Het
Or5k8 T A 16: 58,644,842 (GRCm39) I77F probably damaging Het
Pank1 T C 19: 34,804,754 (GRCm39) H134R probably benign Het
Pcdh7 T A 5: 58,286,458 (GRCm39) M1178K possibly damaging Het
Pcnx3 A T 19: 5,717,633 (GRCm39) I1084N probably damaging Het
Pdcd11 A G 19: 47,093,191 (GRCm39) M490V probably benign Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pitpnc1 C T 11: 107,103,344 (GRCm39) A252T probably damaging Het
Prickle2 A G 6: 92,402,652 (GRCm39) L112P probably damaging Het
Prpf8 A G 11: 75,381,357 (GRCm39) I231V probably benign Het
Scin T A 12: 40,130,984 (GRCm39) M310L probably benign Het
Serpina3m T A 12: 104,355,483 (GRCm39) I50N probably benign Het
Skint8 C G 4: 111,794,274 (GRCm39) N221K probably damaging Het
Slc22a23 C T 13: 34,366,990 (GRCm39) V673M probably benign Het
Slc24a5 A G 2: 124,929,361 (GRCm39) D368G probably damaging Het
Slc28a1 A T 7: 80,776,015 (GRCm39) Q237L possibly damaging Het
Smchd1 T A 17: 71,705,583 (GRCm39) K1005N possibly damaging Het
Stim2 T C 5: 54,262,717 (GRCm39) Y320H probably damaging Het
Syne3 T A 12: 104,919,357 (GRCm39) D512V probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Tcp10a T C 17: 7,601,701 (GRCm39) S216P probably damaging Het
Tmem178b A T 6: 40,184,435 (GRCm39) Q111L probably damaging Het
Tmem236 A G 2: 14,223,861 (GRCm39) I217V probably benign Het
Tmem45b A G 9: 31,340,277 (GRCm39) V128A probably benign Het
Tnfaip2 T C 12: 111,412,456 (GRCm39) Y286H probably damaging Het
Tsc2 T A 17: 24,840,116 (GRCm39) I427L possibly damaging Het
Ttc17 T A 2: 94,132,139 (GRCm39) N1180I possibly damaging Het
Ubr1 T G 2: 120,694,811 (GRCm39) D1707A probably damaging Het
Vmn1r11 A G 6: 57,114,583 (GRCm39) I82M probably benign Het
Vmn2r129 T C 4: 156,687,014 (GRCm39) noncoding transcript Het
Vps41 G T 13: 19,023,904 (GRCm39) probably null Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Zfp629 T C 7: 127,209,616 (GRCm39) H731R probably damaging Het
Zfp712 T C 13: 67,189,960 (GRCm39) E189G possibly damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0962:Acaca UTSW 11 84,202,129 (GRCm39) missense probably damaging 1.00
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1681:Acaca UTSW 11 84,117,011 (GRCm39) missense probably damaging 1.00
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6450:Acaca UTSW 11 84,171,294 (GRCm39) missense probably damaging 0.98
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8000:Acaca UTSW 11 84,283,057 (GRCm39) missense possibly damaging 0.88
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9005:Acaca UTSW 11 84,262,410 (GRCm39) missense probably damaging 0.99
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
R9720:Acaca UTSW 11 84,154,183 (GRCm39) missense probably damaging 1.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAAAGAGAGTCTCCCTAAGATG -3'
(R):5'- TGTGTCTAGAACTGCCCAAAC -3'

Sequencing Primer
(F):5'- GGTACAGAAATTCTTCCAGAAATGGC -3'
(R):5'- GAACTGCCCAAACTAAGAAAAATATC -3'
Posted On 2014-10-01