Incidental Mutation 'R0195:Krt1c'
ID 23395
Institutional Source Beutler Lab
Gene Symbol Krt1c
Ensembl Gene
Gene Name keratin 1 complex
Synonyms Krt-2, Krt2
MMRRC Submission 038454-MU
Accession Numbers
Essential gene? Not available question?
Stock # R0195 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 101721626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 472 (Q472*)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023712
AA Change: Q472*
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: Q472*

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,403,800 (GRCm39) R362P possibly damaging Het
Adam24 T A 8: 41,134,805 (GRCm39) W758R probably benign Het
Adam26b G T 8: 43,973,307 (GRCm39) T565K probably damaging Het
Adam7 T G 14: 68,765,076 (GRCm39) probably benign Het
Adamts19 A G 18: 59,102,942 (GRCm39) probably benign Het
Add1 A G 5: 34,767,990 (GRCm39) probably benign Het
Ago1 A G 4: 126,357,484 (GRCm39) C64R probably benign Het
Ankrd12 C T 17: 66,356,943 (GRCm39) probably null Het
Arhgef33 A G 17: 80,688,863 (GRCm39) K820E probably damaging Het
Arl9 T C 5: 77,154,341 (GRCm39) V8A probably damaging Het
Aspm T C 1: 139,406,873 (GRCm39) L1920P probably damaging Het
Atad2 A G 15: 57,963,350 (GRCm39) probably benign Het
Atp2b2 A T 6: 113,770,835 (GRCm39) V358E probably benign Het
C3ar1 A C 6: 122,828,114 (GRCm39) C34W possibly damaging Het
C6 G A 15: 4,792,953 (GRCm39) V353M probably benign Het
Capn7 T C 14: 31,087,538 (GRCm39) I593T probably damaging Het
Casc3 T A 11: 98,712,319 (GRCm39) D119E probably damaging Het
Ccna1 T A 3: 54,961,785 (GRCm39) E45V probably damaging Het
Cdc37 A G 9: 21,053,576 (GRCm39) V180A probably benign Het
Cdh23 A G 10: 60,152,838 (GRCm39) I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 (GRCm39) probably benign Het
Cngb3 A T 4: 19,280,975 (GRCm39) M15L probably benign Het
Crygn A G 5: 24,961,036 (GRCm39) M90T possibly damaging Het
Cse1l T A 2: 166,782,008 (GRCm39) S661R probably benign Het
D830013O20Rik C T 12: 73,411,095 (GRCm39) noncoding transcript Het
Ddx24 C T 12: 103,385,220 (GRCm39) probably null Het
Dnah3 A T 7: 119,676,998 (GRCm39) probably null Het
Dnah9 C T 11: 65,786,731 (GRCm39) G3634E probably benign Het
Dnttip2 A T 3: 122,069,810 (GRCm39) T342S probably benign Het
Evx2 G T 2: 74,489,388 (GRCm39) R125S probably damaging Het
Fbxl5 A T 5: 43,928,140 (GRCm39) L40Q probably damaging Het
Git1 T A 11: 77,391,899 (GRCm39) D240E probably benign Het
Glp2r T A 11: 67,600,534 (GRCm39) K438N probably damaging Het
Hivep1 T A 13: 42,309,629 (GRCm39) I623N probably benign Het
Il17re A G 6: 113,443,098 (GRCm39) E312G probably damaging Het
Itgb7 G A 15: 102,130,618 (GRCm39) probably benign Het
Itpr3 A G 17: 27,333,088 (GRCm39) Y1900C probably damaging Het
Krtap5-1 A C 7: 141,850,434 (GRCm39) C125G unknown Het
Macf1 A G 4: 123,328,709 (GRCm39) S2554P probably damaging Het
Marchf10 C T 11: 105,276,351 (GRCm39) G646R probably damaging Het
Mrpl48 A C 7: 100,195,560 (GRCm39) probably benign Het
Myo16 A T 8: 10,365,538 (GRCm39) probably benign Het
Nrcam A T 12: 44,631,628 (GRCm39) E1060D probably benign Het
Nsd3 T A 8: 26,170,709 (GRCm39) C731S probably damaging Het
Nup85 T G 11: 115,455,357 (GRCm39) M1R probably null Het
Nxnl2 G T 13: 51,325,483 (GRCm39) R42L probably damaging Het
Oas3 G A 5: 120,894,210 (GRCm39) R39C probably damaging Het
Or13c25 G A 4: 52,910,849 (GRCm39) T315M probably benign Het
Orc1 C T 4: 108,471,505 (GRCm39) R786* probably null Het
P2ry6 A T 7: 100,587,904 (GRCm39) W152R probably damaging Het
Pex5l T C 3: 33,047,102 (GRCm39) N283D possibly damaging Het
Pgk2 T C 17: 40,518,622 (GRCm39) I269V probably benign Het
Phgdh T G 3: 98,223,866 (GRCm39) probably benign Het
Pzp A T 6: 128,464,441 (GRCm39) L1362Q probably damaging Het
Rbbp9 T C 2: 144,390,026 (GRCm39) probably benign Het
Rffl A G 11: 82,700,989 (GRCm39) L244P probably damaging Het
Serpina11 T C 12: 103,952,131 (GRCm39) Y213C probably damaging Het
Spopfm1 A G 3: 94,173,229 (GRCm39) Y79C possibly damaging Het
Srsf11 A G 3: 157,742,172 (GRCm39) probably benign Het
Sspo T A 6: 48,463,570 (GRCm39) V3785E probably benign Het
Svep1 A T 4: 58,089,514 (GRCm39) S1632T possibly damaging Het
Tm4sf1 T A 3: 57,200,480 (GRCm39) D74V probably damaging Het
Tmprss15 T A 16: 78,831,222 (GRCm39) T393S probably benign Het
Tnfaip3 A G 10: 18,881,461 (GRCm39) L275P probably damaging Het
Trim30c A G 7: 104,031,636 (GRCm39) V393A probably benign Het
Tssk2 T A 16: 17,717,439 (GRCm39) S281T probably benign Het
Tubb4a A G 17: 57,388,499 (GRCm39) S176P probably damaging Het
Unc45b T A 11: 82,828,654 (GRCm39) M785K probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn1r176 G T 7: 23,535,010 (GRCm39) Q48K probably benign Het
Vmn2r110 A T 17: 20,794,317 (GRCm39) L784Q probably benign Het
Vps13b A G 15: 35,472,045 (GRCm39) T783A probably benign Het
Zfp800 A G 6: 28,243,846 (GRCm39) M373T probably damaging Het
Zmym1 A G 4: 126,941,704 (GRCm39) F895L possibly damaging Het
Other mutations in Krt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt1c APN 15 101,719,646 (GRCm39) missense probably benign 0.23
IGL01568:Krt1c APN 15 101,721,646 (GRCm39) missense probably damaging 1.00
IGL01586:Krt1c APN 15 101,719,825 (GRCm39) missense unknown
IGL01667:Krt1c APN 15 101,724,765 (GRCm39) missense possibly damaging 0.85
IGL02017:Krt1c APN 15 101,724,939 (GRCm39) missense probably damaging 1.00
IGL02022:Krt1c APN 15 101,724,953 (GRCm39) missense probably damaging 1.00
IGL02538:Krt1c APN 15 101,719,589 (GRCm39) missense unknown
IGL02959:Krt1c APN 15 101,719,763 (GRCm39) missense unknown
IGL03295:Krt1c APN 15 101,724,864 (GRCm39) missense probably damaging 0.99
R0472:Krt1c UTSW 15 101,721,688 (GRCm39) missense probably damaging 1.00
R0749:Krt1c UTSW 15 101,726,098 (GRCm39) missense unknown
R0785:Krt1c UTSW 15 101,726,356 (GRCm39) missense unknown
R0792:Krt1c UTSW 15 101,724,932 (GRCm39) missense probably damaging 1.00
R1232:Krt1c UTSW 15 101,720,219 (GRCm39) missense probably damaging 1.00
R1281:Krt1c UTSW 15 101,721,727 (GRCm39) missense probably damaging 1.00
R1770:Krt1c UTSW 15 101,719,589 (GRCm39) missense unknown
R1783:Krt1c UTSW 15 101,722,408 (GRCm39) missense probably damaging 1.00
R1795:Krt1c UTSW 15 101,724,861 (GRCm39) missense possibly damaging 0.85
R2283:Krt1c UTSW 15 101,722,822 (GRCm39) missense probably damaging 1.00
R3977:Krt1c UTSW 15 101,719,562 (GRCm39) missense unknown
R4575:Krt1c UTSW 15 101,722,921 (GRCm39) missense probably damaging 1.00
R4619:Krt1c UTSW 15 101,726,026 (GRCm39) missense probably damaging 1.00
R4620:Krt1c UTSW 15 101,726,026 (GRCm39) missense probably damaging 1.00
R4766:Krt1c UTSW 15 101,722,395 (GRCm39) missense probably damaging 1.00
R4819:Krt1c UTSW 15 101,719,979 (GRCm39) missense unknown
R4953:Krt1c UTSW 15 101,722,377 (GRCm39) missense probably damaging 1.00
R5108:Krt1c UTSW 15 101,721,721 (GRCm39) missense possibly damaging 0.88
R5973:Krt1c UTSW 15 101,724,747 (GRCm39) missense probably damaging 0.99
R6122:Krt1c UTSW 15 101,724,349 (GRCm39) missense probably damaging 1.00
R6180:Krt1c UTSW 15 101,723,479 (GRCm39) missense probably benign 0.05
R6661:Krt1c UTSW 15 101,724,398 (GRCm39) missense probably damaging 1.00
R6974:Krt1c UTSW 15 101,726,314 (GRCm39) missense unknown
R6993:Krt1c UTSW 15 101,724,395 (GRCm39) missense probably damaging 1.00
R7104:Krt1c UTSW 15 101,723,522 (GRCm39) missense probably benign 0.09
R7573:Krt1c UTSW 15 101,722,954 (GRCm39) missense probably benign 0.05
R7947:Krt1c UTSW 15 101,724,769 (GRCm39) missense probably damaging 1.00
R8469:Krt1c UTSW 15 101,724,804 (GRCm39) missense probably benign 0.22
R8805:Krt1c UTSW 15 101,724,379 (GRCm39) missense possibly damaging 0.93
R9051:Krt1c UTSW 15 101,726,317 (GRCm39) missense unknown
R9118:Krt1c UTSW 15 101,722,976 (GRCm39) missense probably damaging 0.99
R9230:Krt1c UTSW 15 101,725,948 (GRCm39) missense probably benign 0.39
R9257:Krt1c UTSW 15 101,724,926 (GRCm39) missense probably benign 0.05
R9424:Krt1c UTSW 15 101,719,792 (GRCm39) missense unknown
R9569:Krt1c UTSW 15 101,724,924 (GRCm39) missense probably damaging 1.00
R9576:Krt1c UTSW 15 101,719,792 (GRCm39) missense unknown
RF020:Krt1c UTSW 15 101,726,403 (GRCm39) missense unknown
Z1177:Krt1c UTSW 15 101,719,985 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAAGGCTGCTGCTCTCATCCTG -3'
(R):5'- CCAACGATTCTGGTTTCCTGTGCTG -3'

Sequencing Primer
(F):5'- GCTTGGAGAAACCTATTGATGCC -3'
(R):5'- CCTGTGCTGAGTGTCCTGTC -3'
Posted On 2013-04-16