Incidental Mutation 'R2147:Cfap44'
ID233956
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2147 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44451684 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1267 (R1267G)
Ref Sequence ENSEMBL: ENSMUSP00000113908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably benign
Transcript: ENSMUST00000099742
AA Change: R1267G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: R1267G

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120049
AA Change: R1267G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: R1267G

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cep57l1 A G 10: 41,740,899 Y131H probably damaging Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pank1 T C 19: 34,827,354 H134R probably benign Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Skint8 C G 4: 111,937,077 N221K probably damaging Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vmn2r-ps159 T C 4: 156,334,719 noncoding transcript Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGAACAAGTGCATCCTTTCCCTTC -3'
(R):5'- TCTCAAACTCGACGGGCTTC -3'

Sequencing Primer
(F):5'- CCTTCGAGATCTCAAGTTGGCTG -3'
(R):5'- AACTCGACGGGCTTCGGAAG -3'
Posted On2014-10-01