Incidental Mutation 'R2147:Smchd1'
ID 233963
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 040150-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R2147 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71705583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1005 (K1005N)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect possibly damaging
Transcript: ENSMUST00000127430
AA Change: K1005N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: K1005N

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T A 1: 159,903,003 (GRCm39) M91K probably benign Het
Abr T C 11: 76,346,474 (GRCm39) R437G probably damaging Het
Acaca T G 11: 84,167,362 (GRCm39) D1045E probably benign Het
Adam23 A T 1: 63,573,521 (GRCm39) probably null Het
Adam34 A G 8: 44,105,538 (GRCm39) Y36H probably benign Het
Alg11 G A 8: 22,555,309 (GRCm39) G108D probably damaging Het
Alox12e A T 11: 70,210,771 (GRCm39) I316N probably damaging Het
Arid1a A T 4: 133,408,677 (GRCm39) F1943L unknown Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC035044 T C 6: 128,867,867 (GRCm39) probably benign Het
Bcor G A X: 11,923,862 (GRCm39) A578V possibly damaging Het
C1qtnf12 A G 4: 156,050,922 (GRCm39) N297S probably benign Het
Cadps2 G T 6: 23,838,998 (GRCm39) probably benign Het
Ccnf A T 17: 24,449,288 (GRCm39) probably null Het
Cdadc1 A G 14: 59,835,202 (GRCm39) probably null Het
Cep57l1 A G 10: 41,616,895 (GRCm39) Y131H probably damaging Het
Cfap251 T C 5: 123,394,254 (GRCm39) V381A probably benign Het
Cfap44 A G 16: 44,272,047 (GRCm39) R1267G probably benign Het
Chd3 A T 11: 69,239,854 (GRCm39) L1658Q probably benign Het
Chl1 T C 6: 103,692,362 (GRCm39) probably null Het
Chpf2 T A 5: 24,797,033 (GRCm39) F660I probably damaging Het
Cmas T A 6: 142,717,015 (GRCm39) D302E probably benign Het
Cpne3 T A 4: 19,536,562 (GRCm39) M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Dennd3 T G 15: 73,395,336 (GRCm39) L143R probably damaging Het
Dnah2 T C 11: 69,406,587 (GRCm39) M552V probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ergic1 A G 17: 26,855,024 (GRCm39) probably null Het
Fbxl15 A T 19: 46,317,627 (GRCm39) D103V probably damaging Het
Gm4781 C A 10: 100,232,414 (GRCm39) noncoding transcript Het
Hpca A G 4: 129,012,278 (GRCm39) I86T possibly damaging Het
Katnip T A 7: 125,464,492 (GRCm39) H1286Q probably damaging Het
Lamb3 T C 1: 193,010,212 (GRCm39) V275A probably benign Het
Lipe G T 7: 25,087,946 (GRCm39) A38E probably benign Het
Lrrk1 A T 7: 65,935,159 (GRCm39) probably null Het
Lrsam1 T C 2: 32,835,891 (GRCm39) K292R probably damaging Het
Mbtps1 A T 8: 120,265,598 (GRCm39) H316Q probably benign Het
Mms22l T A 4: 24,580,063 (GRCm39) Y525* probably null Het
Mrps14 T C 1: 160,022,862 (GRCm39) L9P possibly damaging Het
Mycbp2 G A 14: 103,393,358 (GRCm39) H3068Y probably damaging Het
Myo15a A G 11: 60,401,055 (GRCm39) D2992G possibly damaging Het
N4bp2 T A 5: 65,966,543 (GRCm39) L1327Q probably damaging Het
Nradd A T 9: 110,451,243 (GRCm39) F42I probably benign Het
Or5k8 T A 16: 58,644,842 (GRCm39) I77F probably damaging Het
Pank1 T C 19: 34,804,754 (GRCm39) H134R probably benign Het
Pcdh7 T A 5: 58,286,458 (GRCm39) M1178K possibly damaging Het
Pcnx3 A T 19: 5,717,633 (GRCm39) I1084N probably damaging Het
Pdcd11 A G 19: 47,093,191 (GRCm39) M490V probably benign Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pitpnc1 C T 11: 107,103,344 (GRCm39) A252T probably damaging Het
Prickle2 A G 6: 92,402,652 (GRCm39) L112P probably damaging Het
Prpf8 A G 11: 75,381,357 (GRCm39) I231V probably benign Het
Scin T A 12: 40,130,984 (GRCm39) M310L probably benign Het
Serpina3m T A 12: 104,355,483 (GRCm39) I50N probably benign Het
Skint8 C G 4: 111,794,274 (GRCm39) N221K probably damaging Het
Slc22a23 C T 13: 34,366,990 (GRCm39) V673M probably benign Het
Slc24a5 A G 2: 124,929,361 (GRCm39) D368G probably damaging Het
Slc28a1 A T 7: 80,776,015 (GRCm39) Q237L possibly damaging Het
Stim2 T C 5: 54,262,717 (GRCm39) Y320H probably damaging Het
Syne3 T A 12: 104,919,357 (GRCm39) D512V probably damaging Het
Tada2a T C 11: 83,970,455 (GRCm39) D432G probably damaging Het
Tcp10a T C 17: 7,601,701 (GRCm39) S216P probably damaging Het
Tmem178b A T 6: 40,184,435 (GRCm39) Q111L probably damaging Het
Tmem236 A G 2: 14,223,861 (GRCm39) I217V probably benign Het
Tmem45b A G 9: 31,340,277 (GRCm39) V128A probably benign Het
Tnfaip2 T C 12: 111,412,456 (GRCm39) Y286H probably damaging Het
Tsc2 T A 17: 24,840,116 (GRCm39) I427L possibly damaging Het
Ttc17 T A 2: 94,132,139 (GRCm39) N1180I possibly damaging Het
Ubr1 T G 2: 120,694,811 (GRCm39) D1707A probably damaging Het
Vmn1r11 A G 6: 57,114,583 (GRCm39) I82M probably benign Het
Vmn2r129 T C 4: 156,687,014 (GRCm39) noncoding transcript Het
Vps41 G T 13: 19,023,904 (GRCm39) probably null Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Zfp629 T C 7: 127,209,616 (GRCm39) H731R probably damaging Het
Zfp712 T C 13: 67,189,960 (GRCm39) E189G possibly damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCAAGGGACCCAATGTC -3'
(R):5'- AGGCAGCAGTGTTAGCTGTG -3'

Sequencing Primer
(F):5'- GGACCCAATGTCTCTGTTCTCAC -3'
(R):5'- GCAGTGTTAGCTGTGGTAAATTATTC -3'
Posted On 2014-10-01