Incidental Mutation 'R2148:Ppfia4'
ID233978
Institutional Source Beutler Lab
Gene Symbol Ppfia4
Ensembl Gene ENSMUSG00000026458
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
MMRRC Submission 040151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2148 (G1)
Quality Score222
Status Not validated
Chromosome1
Chromosomal Location134296783-134332928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134312634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 591 (I591V)
Ref Sequence ENSEMBL: ENSMUSP00000139800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168515] [ENSMUST00000186730] [ENSMUST00000189361]
Predicted Effect probably benign
Transcript: ENSMUST00000168515
AA Change: I874V

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458
AA Change: I874V

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186553
Predicted Effect probably benign
Transcript: ENSMUST00000186730
AA Change: I591V

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458
AA Change: I591V

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189361
AA Change: I874V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458
AA Change: I874V

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,615,764 Y4796C probably damaging Het
Actn2 A T 13: 12,300,949 M228K probably damaging Het
Agbl1 T G 7: 76,414,717 probably null Het
Ahi1 T G 10: 20,970,976 V435G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
Bop1 A G 15: 76,455,287 V286A probably damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cacna1a A T 8: 84,629,675 Q1887L possibly damaging Het
Cadps2 G T 6: 23,838,999 probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Cnot2 A G 10: 116,506,280 I173T probably benign Het
Cntnap5b T A 1: 100,383,474 I564N probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dgkd T G 1: 87,881,921 N110K probably damaging Het
Dhx8 A T 11: 101,738,377 R198* probably null Het
Dnah8 A T 17: 30,737,258 I2071F probably damaging Het
Dsc3 C T 18: 19,965,638 R828Q probably damaging Het
Fbxl4 T C 4: 22,427,333 F525L possibly damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpatch1 A G 7: 35,299,276 V343A probably benign Het
Gpr139 A G 7: 119,144,969 V131A probably benign Het
Hamp T C 7: 30,942,712 T34A possibly damaging Het
Homer2 T G 7: 81,624,295 D51A possibly damaging Het
Hspa1l C T 17: 34,977,390 A135V probably damaging Het
Igsf10 A G 3: 59,336,577 M112T possibly damaging Het
Ikbkb A T 8: 22,682,745 L153Q probably damaging Het
Kif19a A T 11: 114,780,768 I158F probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Llcfc1 G A 6: 41,685,221 G53D possibly damaging Het
Loxl4 A G 19: 42,604,192 probably null Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Mak T C 13: 41,042,037 K400R probably benign Het
Mgat4c T C 10: 102,388,929 F335L probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mtor T C 4: 148,456,012 F245L possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo5a T A 9: 75,180,147 L1095H probably damaging Het
Nlrp1a T A 11: 71,122,907 K506* probably null Het
Olfr73 C A 2: 88,034,599 C180F probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Phkb A G 8: 86,017,486 D588G probably damaging Het
Pkd1l2 A T 8: 117,056,325 I752N probably damaging Het
Pkhd1 C A 1: 20,414,220 probably null Het
Plod3 C T 5: 136,987,773 R30* probably null Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Ptgs2 G T 1: 150,105,714 A583S probably benign Het
Pycr2 T C 1: 180,906,848 V231A probably damaging Het
Ralgapa2 T C 2: 146,431,887 D540G probably benign Het
Rasal1 T A 5: 120,662,031 I150N probably damaging Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Sacs T C 14: 61,173,378 L34P probably damaging Het
Sema3d A G 5: 12,484,959 Y106C probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Slc19a2 T C 1: 164,262,088 W158R probably damaging Het
Sorbs1 A T 19: 40,376,824 F172I possibly damaging Het
Spaca7 A T 8: 12,586,447 D91V probably damaging Het
Tead3 A G 17: 28,333,664 F187L probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Trap1 T C 16: 4,060,760 D236G probably damaging Het
Trim45 T A 3: 100,932,044 L754* probably null Het
Tubgcp5 A G 7: 55,799,511 E152G probably damaging Het
Uaca A T 9: 60,869,679 L447F probably damaging Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wdr11 A G 7: 129,629,083 probably null Het
Zfp462 T A 4: 55,013,670 S1879T probably benign Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Ppfia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Ppfia4 APN 1 134328086 missense probably benign 0.00
IGL01935:Ppfia4 APN 1 134317936 missense probably benign 0.02
IGL02008:Ppfia4 APN 1 134332391 missense probably damaging 1.00
R0037:Ppfia4 UTSW 1 134324089 missense probably damaging 1.00
R0084:Ppfia4 UTSW 1 134299426 missense possibly damaging 0.84
R0108:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0254:Ppfia4 UTSW 1 134324224 splice site probably benign
R0445:Ppfia4 UTSW 1 134327289 missense probably benign 0.31
R0504:Ppfia4 UTSW 1 134324113 missense probably damaging 1.00
R0617:Ppfia4 UTSW 1 134328780 missense probably damaging 1.00
R0839:Ppfia4 UTSW 1 134328807 missense probably null 1.00
R0849:Ppfia4 UTSW 1 134319372 missense probably benign 0.45
R0898:Ppfia4 UTSW 1 134321126 missense probably benign
R1173:Ppfia4 UTSW 1 134332283 splice site probably benign
R1728:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1729:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1730:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1762:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1783:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1784:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1785:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1812:Ppfia4 UTSW 1 134324573 missense probably benign 0.04
R2160:Ppfia4 UTSW 1 134313723 missense probably benign 0.40
R2308:Ppfia4 UTSW 1 134332397 missense possibly damaging 0.94
R2421:Ppfia4 UTSW 1 134327400 missense probably benign 0.00
R3694:Ppfia4 UTSW 1 134312567 missense probably damaging 1.00
R3707:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3708:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3725:Ppfia4 UTSW 1 134313711 missense probably benign 0.04
R3964:Ppfia4 UTSW 1 134323016 missense probably benign
R4889:Ppfia4 UTSW 1 134300514 missense probably damaging 1.00
R4909:Ppfia4 UTSW 1 134332501 missense probably damaging 0.97
R4939:Ppfia4 UTSW 1 134328079 missense possibly damaging 0.67
R5226:Ppfia4 UTSW 1 134304286 critical splice donor site probably null
R5433:Ppfia4 UTSW 1 134317894 missense probably damaging 1.00
R5576:Ppfia4 UTSW 1 134323050 missense possibly damaging 0.81
R5727:Ppfia4 UTSW 1 134324077 critical splice donor site probably null
R5793:Ppfia4 UTSW 1 134312106 missense probably damaging 1.00
R6193:Ppfia4 UTSW 1 134324161 missense probably benign 0.04
R6216:Ppfia4 UTSW 1 134329183 missense probably damaging 1.00
R6679:Ppfia4 UTSW 1 134309679 missense probably damaging 1.00
R6742:Ppfia4 UTSW 1 134329171 missense probably damaging 1.00
R7039:Ppfia4 UTSW 1 134312115 missense probably damaging 0.97
R7206:Ppfia4 UTSW 1 134327389 missense probably benign 0.00
R7259:Ppfia4 UTSW 1 134313100 missense probably damaging 1.00
R7454:Ppfia4 UTSW 1 134324135 missense possibly damaging 0.87
R8139:Ppfia4 UTSW 1 134300528 missense probably benign 0.01
Z1176:Ppfia4 UTSW 1 134327379 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTAAAGCAGGGCTCAGTACTCC -3'
(R):5'- AGTCTTTCACAGGCAGACTC -3'

Sequencing Primer
(F):5'- CCGCCTTCCTAAAGACCAGTAGG -3'
(R):5'- TCACAGGCAGACTCGCTCTC -3'
Posted On2014-10-01