Incidental Mutation 'R2148:Cadps2'
ID234004
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene NameCa2+-dependent activator protein for secretion 2
SynonymsCaps2, cpd2, A230044C21Rik
MMRRC Submission 040151-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2148 (G1)
Quality Score130
Status Not validated
Chromosome6
Chromosomal Location23262773-23839421 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 23838999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000018122
AA Change: R47S
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000069074
AA Change: R47S
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115355
SMART Domains Protein: ENSMUSP00000111012
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115356
AA Change: R47S
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115358
AA Change: R47S
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115361
AA Change: R47S
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136279
Predicted Effect probably benign
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163871
AA Change: R47S
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: R47S

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,615,764 Y4796C probably damaging Het
Actn2 A T 13: 12,300,949 M228K probably damaging Het
Agbl1 T G 7: 76,414,717 probably null Het
Ahi1 T G 10: 20,970,976 V435G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
Bop1 A G 15: 76,455,287 V286A probably damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cacna1a A T 8: 84,629,675 Q1887L possibly damaging Het
Chl1 T C 6: 103,715,401 probably null Het
Cnot2 A G 10: 116,506,280 I173T probably benign Het
Cntnap5b T A 1: 100,383,474 I564N probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dgkd T G 1: 87,881,921 N110K probably damaging Het
Dhx8 A T 11: 101,738,377 R198* probably null Het
Dnah8 A T 17: 30,737,258 I2071F probably damaging Het
Dsc3 C T 18: 19,965,638 R828Q probably damaging Het
Fbxl4 T C 4: 22,427,333 F525L possibly damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpatch1 A G 7: 35,299,276 V343A probably benign Het
Gpr139 A G 7: 119,144,969 V131A probably benign Het
Hamp T C 7: 30,942,712 T34A possibly damaging Het
Homer2 T G 7: 81,624,295 D51A possibly damaging Het
Hspa1l C T 17: 34,977,390 A135V probably damaging Het
Igsf10 A G 3: 59,336,577 M112T possibly damaging Het
Ikbkb A T 8: 22,682,745 L153Q probably damaging Het
Kif19a A T 11: 114,780,768 I158F probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Llcfc1 G A 6: 41,685,221 G53D possibly damaging Het
Loxl4 A G 19: 42,604,192 probably null Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Mak T C 13: 41,042,037 K400R probably benign Het
Mgat4c T C 10: 102,388,929 F335L probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mtor T C 4: 148,456,012 F245L possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo5a T A 9: 75,180,147 L1095H probably damaging Het
Nlrp1a T A 11: 71,122,907 K506* probably null Het
Olfr73 C A 2: 88,034,599 C180F probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Phkb A G 8: 86,017,486 D588G probably damaging Het
Pkd1l2 A T 8: 117,056,325 I752N probably damaging Het
Pkhd1 C A 1: 20,414,220 probably null Het
Plod3 C T 5: 136,987,773 R30* probably null Het
Ppfia4 T C 1: 134,312,634 I591V probably benign Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Ptgs2 G T 1: 150,105,714 A583S probably benign Het
Pycr2 T C 1: 180,906,848 V231A probably damaging Het
Ralgapa2 T C 2: 146,431,887 D540G probably benign Het
Rasal1 T A 5: 120,662,031 I150N probably damaging Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Sacs T C 14: 61,173,378 L34P probably damaging Het
Sema3d A G 5: 12,484,959 Y106C probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Slc19a2 T C 1: 164,262,088 W158R probably damaging Het
Sorbs1 A T 19: 40,376,824 F172I possibly damaging Het
Spaca7 A T 8: 12,586,447 D91V probably damaging Het
Tead3 A G 17: 28,333,664 F187L probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Trap1 T C 16: 4,060,760 D236G probably damaging Het
Trim45 T A 3: 100,932,044 L754* probably null Het
Tubgcp5 A G 7: 55,799,511 E152G probably damaging Het
Uaca A T 9: 60,869,679 L447F probably damaging Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wdr11 A G 7: 129,629,083 probably null Het
Zfp462 T A 4: 55,013,670 S1879T probably benign Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAATGGGTACGCGATGC -3'
(R):5'- AACTCGACGTGTCCGGAAAG -3'

Sequencing Primer
(F):5'- ATGGGTACGCGATGCACCTC -3'
(R):5'- AAAGCCCGGGCCACTTTC -3'
Posted On2014-10-01