Incidental Mutation 'R2148:Cacna1a'
ID234018
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
MMRRC Submission 040151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R2148 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84629675 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1887 (Q1887L)
Ref Sequence ENSEMBL: ENSMUSP00000112436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121390
AA Change: Q1887L

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: Q1887L

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122053
AA Change: Q1840L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: Q1840L

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144879
Predicted Effect unknown
Transcript: ENSMUST00000215756
AA Change: Q1839L
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,615,764 Y4796C probably damaging Het
Actn2 A T 13: 12,300,949 M228K probably damaging Het
Agbl1 T G 7: 76,414,717 probably null Het
Ahi1 T G 10: 20,970,976 V435G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
Bop1 A G 15: 76,455,287 V286A probably damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Cnot2 A G 10: 116,506,280 I173T probably benign Het
Cntnap5b T A 1: 100,383,474 I564N probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dgkd T G 1: 87,881,921 N110K probably damaging Het
Dhx8 A T 11: 101,738,377 R198* probably null Het
Dnah8 A T 17: 30,737,258 I2071F probably damaging Het
Dsc3 C T 18: 19,965,638 R828Q probably damaging Het
Fbxl4 T C 4: 22,427,333 F525L possibly damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpatch1 A G 7: 35,299,276 V343A probably benign Het
Gpr139 A G 7: 119,144,969 V131A probably benign Het
Hamp T C 7: 30,942,712 T34A possibly damaging Het
Homer2 T G 7: 81,624,295 D51A possibly damaging Het
Hspa1l C T 17: 34,977,390 A135V probably damaging Het
Igsf10 A G 3: 59,336,577 M112T possibly damaging Het
Ikbkb A T 8: 22,682,745 L153Q probably damaging Het
Kif19a A T 11: 114,780,768 I158F probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Llcfc1 G A 6: 41,685,221 G53D possibly damaging Het
Loxl4 A G 19: 42,604,192 probably null Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Mak T C 13: 41,042,037 K400R probably benign Het
Mgat4c T C 10: 102,388,929 F335L probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mtor T C 4: 148,456,012 F245L possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo5a T A 9: 75,180,147 L1095H probably damaging Het
Nlrp1a T A 11: 71,122,907 K506* probably null Het
Olfr73 C A 2: 88,034,599 C180F probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Phkb A G 8: 86,017,486 D588G probably damaging Het
Pkd1l2 A T 8: 117,056,325 I752N probably damaging Het
Pkhd1 C A 1: 20,414,220 probably null Het
Plod3 C T 5: 136,987,773 R30* probably null Het
Ppfia4 T C 1: 134,312,634 I591V probably benign Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Ptgs2 G T 1: 150,105,714 A583S probably benign Het
Pycr2 T C 1: 180,906,848 V231A probably damaging Het
Ralgapa2 T C 2: 146,431,887 D540G probably benign Het
Rasal1 T A 5: 120,662,031 I150N probably damaging Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Sacs T C 14: 61,173,378 L34P probably damaging Het
Sema3d A G 5: 12,484,959 Y106C probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Slc19a2 T C 1: 164,262,088 W158R probably damaging Het
Sorbs1 A T 19: 40,376,824 F172I possibly damaging Het
Spaca7 A T 8: 12,586,447 D91V probably damaging Het
Tead3 A G 17: 28,333,664 F187L probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Trap1 T C 16: 4,060,760 D236G probably damaging Het
Trim45 T A 3: 100,932,044 L754* probably null Het
Tubgcp5 A G 7: 55,799,511 E152G probably damaging Het
Uaca A T 9: 60,869,679 L447F probably damaging Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wdr11 A G 7: 129,629,083 probably null Het
Zfp462 T A 4: 55,013,670 S1879T probably benign Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
R7409:Cacna1a UTSW 8 84533402 missense probably damaging 1.00
R7491:Cacna1a UTSW 8 84559293 missense possibly damaging 0.92
R7511:Cacna1a UTSW 8 84567682 missense possibly damaging 0.75
R7745:Cacna1a UTSW 8 84559394 missense probably benign 0.01
R7872:Cacna1a UTSW 8 84583654 missense probably damaging 1.00
R7899:Cacna1a UTSW 8 84594173 missense possibly damaging 0.72
R7955:Cacna1a UTSW 8 84583654 missense probably damaging 1.00
R7982:Cacna1a UTSW 8 84594173 missense possibly damaging 0.72
RF029:Cacna1a UTSW 8 84638724 small insertion probably benign
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGCAGTTGGAAATGGATCCTGG -3'
(R):5'- TGATCATCATGGCTGCGTAG -3'

Sequencing Primer
(F):5'- AAATGGATCCTGGCCCTTG -3'
(R):5'- TAGCTTTGCCTCCTCCCCGAGG -3'
Posted On2014-10-01