Mutagenetix > Incidental Mutation

Incidental Mutation 'R0195:Adamts19'

23405

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

038454-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 58969870 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably benign
Transcript: ENSMUST00000052907

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.4%

Validation Efficiency

98% (156/160)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	C	G	11: 100,512,974	R362P	possibly damaging	Het
Adam24	T	A	8: 40,681,766	W758R	probably benign	Het
Adam26b	G	T	8: 43,520,270	T565K	probably damaging	Het
Adam7	T	G	14: 68,527,627		probably benign	Het
Add1	A	G	5: 34,610,646		probably benign	Het
Ago1	A	G	4: 126,463,691	C64R	probably benign	Het
Ankrd12	C	T	17: 66,049,948		probably null	Het
Arhgef33	A	G	17: 80,381,434	K820E	probably damaging	Het
Arl9	T	C	5: 77,006,494	V8A	probably damaging	Het
Aspm	T	C	1: 139,479,135	L1920P	probably damaging	Het
Atad2	A	G	15: 58,099,954		probably benign	Het
Atp2b2	A	T	6: 113,793,874	V358E	probably benign	Het
C3ar1	A	C	6: 122,851,155	C34W	possibly damaging	Het
C6	G	A	15: 4,763,471	V353M	probably benign	Het
Capn7	T	C	14: 31,365,581	I593T	probably damaging	Het
Casc3	T	A	11: 98,821,493	D119E	probably damaging	Het
Ccna1	T	A	3: 55,054,364	E45V	probably damaging	Het
Cdc37	A	G	9: 21,142,280	V180A	probably benign	Het
Cdh23	A	G	10: 60,317,059	I2393T	probably damaging	Het
Cnbd1	T	C	4: 18,906,988		probably benign	Het
Cngb3	A	T	4: 19,280,975	M15L	probably benign	Het
Crygn	A	G	5: 24,756,038	M90T	possibly damaging	Het
Cse1l	T	A	2: 166,940,088	S661R	probably benign	Het
D830013O20Rik	C	T	12: 73,364,321		noncoding transcript	Het
Ddx24	C	T	12: 103,418,961		probably null	Het
Dnah3	A	T	7: 120,077,775		probably null	Het
Dnah9	C	T	11: 65,895,905	G3634E	probably benign	Het
Dnttip2	A	T	3: 122,276,161	T342S	probably benign	Het
Evx2	G	T	2: 74,659,044	R125S	probably damaging	Het
Fbxl5	A	T	5: 43,770,798	L40Q	probably damaging	Het
Git1	T	A	11: 77,501,073	D240E	probably benign	Het
Glp2r	T	A	11: 67,709,708	K438N	probably damaging	Het
Gm4778	A	G	3: 94,265,922	Y79C	possibly damaging	Het
Hivep1	T	A	13: 42,156,153	I623N	probably benign	Het
Il17re	A	G	6: 113,466,137	E312G	probably damaging	Het
Itgb7	G	A	15: 102,222,183		probably benign	Het
Itpr3	A	G	17: 27,114,114	Y1900C	probably damaging	Het
Krt2	G	A	15: 101,813,191	Q472*	probably null	Het
Krtap5-1	A	C	7: 142,296,697	C125G	unknown	Het
Macf1	A	G	4: 123,434,916	S2554P	probably damaging	Het
March10	C	T	11: 105,385,525	G646R	probably damaging	Het
Mrpl48	A	C	7: 100,546,353		probably benign	Het
Myo16	A	T	8: 10,315,538		probably benign	Het
Nrcam	A	T	12: 44,584,845	E1060D	probably benign	Het
Nsd3	T	A	8: 25,680,693	C731S	probably damaging	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Nxnl2	G	T	13: 51,171,447	R42L	probably damaging	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Orc1	C	T	4: 108,614,308	R786*	probably null	Het
P2ry6	A	T	7: 100,938,697	W152R	probably damaging	Het
Pex5l	T	C	3: 32,992,953	N283D	possibly damaging	Het
Pgk2	T	C	17: 40,207,731	I269V	probably benign	Het
Phgdh	T	G	3: 98,316,550		probably benign	Het
Pzp	A	T	6: 128,487,478	L1362Q	probably damaging	Het
Rbbp9	T	C	2: 144,548,106		probably benign	Het
Rffl	A	G	11: 82,810,163	L244P	probably damaging	Het
Serpina11	T	C	12: 103,985,872	Y213C	probably damaging	Het
Srsf11	A	G	3: 158,036,535		probably benign	Het
Sspo	T	A	6: 48,486,636	V3785E	probably benign	Het
Svep1	A	T	4: 58,089,514	S1632T	possibly damaging	Het
Tm4sf1	T	A	3: 57,293,059	D74V	probably damaging	Het
Tmprss15	T	A	16: 79,034,334	T393S	probably benign	Het
Tnfaip3	A	G	10: 19,005,713	L275P	probably damaging	Het
Trim30c	A	G	7: 104,382,429	V393A	probably benign	Het
Tssk2	T	A	16: 17,899,575	S281T	probably benign	Het
Tubb4a	A	G	17: 57,081,499	S176P	probably damaging	Het
Unc45b	T	A	11: 82,937,828	M785K	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn1r176	G	T	7: 23,835,585	Q48K	probably benign	Het
Vmn2r110	A	T	17: 20,574,055	L784Q	probably benign	Het
Vps13b	A	G	15: 35,471,899	T783A	probably benign	Het
Zfp800	A	G	6: 28,243,847	M373T	probably damaging	Het
Zmym1	A	G	4: 127,047,911	F895L	possibly damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ACATGTTGCACCGAGTTCTGCC -3'
(R):5'- CCTTCATCGAAGACAGCTTGCCAC -3'

Sequencing Primer
(F):5'- CGAGTTCTGCCCTTGAATTTTG -3'
(R):5'- AGCTTGCCACTGAAGTGC -3'

Posted On

2013-04-16