Incidental Mutation 'R2148:Bcor'
ID 234057
Institutional Source Beutler Lab
Gene Symbol Bcor
Ensembl Gene ENSMUSG00000040363
Gene Name BCL6 interacting corepressor
Synonyms 5830466J11Rik, D930024N20Rik, 8430401K06Rik
MMRRC Submission 040151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock # R2148 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 12036740-12160355 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12057623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 578 (A578V)
Ref Sequence ENSEMBL: ENSMUSP00000116258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043441] [ENSMUST00000065143] [ENSMUST00000115512] [ENSMUST00000115513] [ENSMUST00000123004] [ENSMUST00000124033] [ENSMUST00000145872]
AlphaFold Q8CGN4
Predicted Effect possibly damaging
Transcript: ENSMUST00000043441
AA Change: A578V

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048024
Gene: ENSMUSG00000040363
AA Change: A578V

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000065143
AA Change: A578V

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068618
Gene: ENSMUSG00000040363
AA Change: A578V

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
ANK 1432 1462 1.6e1 SMART
ANK 1466 1495 8.26e-2 SMART
ANK 1499 1528 3.06e-5 SMART
low complexity region 1590 1601 N/A INTRINSIC
PDB:4HPL|A 1602 1718 2e-67 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000115512
AA Change: A578V

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111174
Gene: ENSMUSG00000040363
AA Change: A578V

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1408 1421 N/A INTRINSIC
ANK 1448 1478 1.6e1 SMART
ANK 1482 1511 8.26e-2 SMART
ANK 1515 1544 3.06e-5 SMART
low complexity region 1606 1617 N/A INTRINSIC
PDB:4HPL|A 1618 1734 2e-67 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000115513
AA Change: A578V

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111175
Gene: ENSMUSG00000040363
AA Change: A578V

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
Pfam:BCOR 1205 1417 1.6e-77 PFAM
low complexity region 1426 1439 N/A INTRINSIC
ANK 1466 1496 1.6e1 SMART
ANK 1500 1529 8.26e-2 SMART
ANK 1533 1562 3.06e-5 SMART
low complexity region 1624 1635 N/A INTRINSIC
Pfam:PUFD 1638 1751 5.6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123004
Predicted Effect possibly damaging
Transcript: ENSMUST00000124033
AA Change: A578V

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116258
Gene: ENSMUSG00000040363
AA Change: A578V

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000145872
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010]
PHENOTYPE: Male chimeras hemizygous for either of two different gene trapped alleles die by E9.5 exhibiting anomalies in somite formation and heart looping, forebrain fusion, and microcephaly. Hemizygosity for other gene trapped alleles can cause patterning and embryo turning defects or abnormal gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,615,764 Y4796C probably damaging Het
Actn2 A T 13: 12,300,949 M228K probably damaging Het
Agbl1 T G 7: 76,414,717 probably null Het
Ahi1 T G 10: 20,970,976 V435G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
Bop1 A G 15: 76,455,287 V286A probably damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cacna1a A T 8: 84,629,675 Q1887L possibly damaging Het
Cadps2 G T 6: 23,838,999 probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Cnot2 A G 10: 116,506,280 I173T probably benign Het
Cntnap5b T A 1: 100,383,474 I564N probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dgkd T G 1: 87,881,921 N110K probably damaging Het
Dhx8 A T 11: 101,738,377 R198* probably null Het
Dnah8 A T 17: 30,737,258 I2071F probably damaging Het
Dsc3 C T 18: 19,965,638 R828Q probably damaging Het
Fbxl4 T C 4: 22,427,333 F525L possibly damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpatch1 A G 7: 35,299,276 V343A probably benign Het
Gpr139 A G 7: 119,144,969 V131A probably benign Het
Hamp T C 7: 30,942,712 T34A possibly damaging Het
Homer2 T G 7: 81,624,295 D51A possibly damaging Het
Hspa1l C T 17: 34,977,390 A135V probably damaging Het
Igsf10 A G 3: 59,336,577 M112T possibly damaging Het
Ikbkb A T 8: 22,682,745 L153Q probably damaging Het
Kif19a A T 11: 114,780,768 I158F probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Llcfc1 G A 6: 41,685,221 G53D possibly damaging Het
Loxl4 A G 19: 42,604,192 probably null Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Mak T C 13: 41,042,037 K400R probably benign Het
Mgat4c T C 10: 102,388,929 F335L probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mtor T C 4: 148,456,012 F245L possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo5a T A 9: 75,180,147 L1095H probably damaging Het
Nlrp1a T A 11: 71,122,907 K506* probably null Het
Olfr73 C A 2: 88,034,599 C180F probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Phkb A G 8: 86,017,486 D588G probably damaging Het
Pkd1l2 A T 8: 117,056,325 I752N probably damaging Het
Pkhd1 C A 1: 20,414,220 probably null Het
Plod3 C T 5: 136,987,773 R30* probably null Het
Ppfia4 T C 1: 134,312,634 I591V probably benign Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Ptgs2 G T 1: 150,105,714 A583S probably benign Het
Pycr2 T C 1: 180,906,848 V231A probably damaging Het
Ralgapa2 T C 2: 146,431,887 D540G probably benign Het
Rasal1 T A 5: 120,662,031 I150N probably damaging Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Sacs T C 14: 61,173,378 L34P probably damaging Het
Sema3d A G 5: 12,484,959 Y106C probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Slc19a2 T C 1: 164,262,088 W158R probably damaging Het
Sorbs1 A T 19: 40,376,824 F172I possibly damaging Het
Spaca7 A T 8: 12,586,447 D91V probably damaging Het
Tead3 A G 17: 28,333,664 F187L probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Trap1 T C 16: 4,060,760 D236G probably damaging Het
Trim45 T A 3: 100,932,044 L754* probably null Het
Tubgcp5 A G 7: 55,799,511 E152G probably damaging Het
Uaca A T 9: 60,869,679 L447F probably damaging Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wdr11 A G 7: 129,629,083 probably null Het
Zfp462 T A 4: 55,013,670 S1879T probably benign Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Bcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Bcor APN X 12037820 missense probably damaging 0.99
IGL02034:Bcor APN X 12039259 missense possibly damaging 0.46
IGL02458:Bcor APN X 12048510 missense probably damaging 1.00
IGL03330:Bcor APN X 12058871 missense possibly damaging 0.65
R0648:Bcor UTSW X 12059051 missense probably damaging 1.00
R2147:Bcor UTSW X 12057623 missense possibly damaging 0.73
R4941:Bcor UTSW X 12040486 missense probably damaging 1.00
R5004:Bcor UTSW X 12040486 missense probably damaging 1.00
R5162:Bcor UTSW X 12040486 missense probably damaging 1.00
R5163:Bcor UTSW X 12040486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCATTCTCACTCGCTTTG -3'
(R):5'- AGAGATCATCAGCACTGCTCC -3'

Sequencing Primer
(F):5'- CTTTGAAGCTCGGTTCTGGG -3'
(R):5'- TGCCAGGGCCAAGTCCTAATG -3'
Posted On 2014-10-01