Incidental Mutation 'R2149:Abca12'
ID 234066
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene Name ATP-binding cassette, sub-family A member 12
Synonyms 4833417A11Rik, 4832428G11Rik
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 71282249-71454069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 71302647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 2191 (V2191L)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
AlphaFold E9Q876
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: V2191L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: V2191L

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Meta Mutation Damage Score 0.1537 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71,342,700 (GRCm39) missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71,392,916 (GRCm39) missense probably benign 0.00
IGL00813:Abca12 APN 1 71,392,921 (GRCm39) critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71,341,892 (GRCm39) missense probably damaging 1.00
IGL00921:Abca12 APN 1 71,324,888 (GRCm39) missense probably damaging 1.00
IGL01011:Abca12 APN 1 71,302,791 (GRCm39) missense probably benign 0.02
IGL01066:Abca12 APN 1 71,392,889 (GRCm39) missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71,353,273 (GRCm39) missense probably damaging 1.00
IGL01310:Abca12 APN 1 71,323,315 (GRCm39) missense probably benign 0.00
IGL01360:Abca12 APN 1 71,325,648 (GRCm39) missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71,359,045 (GRCm39) missense probably benign 0.00
IGL01608:Abca12 APN 1 71,298,601 (GRCm39) missense probably damaging 1.00
IGL01687:Abca12 APN 1 71,306,769 (GRCm39) splice site probably benign
IGL01700:Abca12 APN 1 71,319,549 (GRCm39) missense probably benign
IGL01723:Abca12 APN 1 71,353,327 (GRCm39) missense probably benign 0.01
IGL01804:Abca12 APN 1 71,315,342 (GRCm39) missense probably benign 0.01
IGL01982:Abca12 APN 1 71,385,857 (GRCm39) missense probably benign 0.34
IGL02136:Abca12 APN 1 71,286,301 (GRCm39) missense probably damaging 1.00
IGL02172:Abca12 APN 1 71,341,817 (GRCm39) missense probably benign 0.09
IGL02222:Abca12 APN 1 71,322,045 (GRCm39) missense probably benign 0.40
IGL02266:Abca12 APN 1 71,307,360 (GRCm39) nonsense probably null
IGL02449:Abca12 APN 1 71,440,908 (GRCm39) splice site probably null
IGL02471:Abca12 APN 1 71,297,357 (GRCm39) missense probably benign 0.00
IGL02496:Abca12 APN 1 71,327,712 (GRCm39) missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71,333,906 (GRCm39) missense probably damaging 0.96
IGL02795:Abca12 APN 1 71,327,907 (GRCm39) missense probably damaging 1.00
IGL03000:Abca12 APN 1 71,360,959 (GRCm39) missense probably benign 0.01
IGL03031:Abca12 APN 1 71,353,183 (GRCm39) missense probably benign 0.00
IGL03131:Abca12 APN 1 71,385,861 (GRCm39) missense probably benign
IGL03260:Abca12 APN 1 71,323,258 (GRCm39) missense probably damaging 1.00
IGL03324:Abca12 APN 1 71,353,167 (GRCm39) missense probably benign
IGL03408:Abca12 APN 1 71,303,954 (GRCm39) missense probably damaging 1.00
R0016:Abca12 UTSW 1 71,333,959 (GRCm39) missense probably benign 0.35
R0016:Abca12 UTSW 1 71,333,959 (GRCm39) missense probably benign 0.35
R0121:Abca12 UTSW 1 71,298,945 (GRCm39) splice site probably null
R0172:Abca12 UTSW 1 71,318,561 (GRCm39) missense probably damaging 0.99
R0196:Abca12 UTSW 1 71,298,972 (GRCm39) missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71,298,935 (GRCm39) splice site probably benign
R0466:Abca12 UTSW 1 71,341,822 (GRCm39) missense probably damaging 1.00
R0616:Abca12 UTSW 1 71,341,830 (GRCm39) missense probably damaging 1.00
R0668:Abca12 UTSW 1 71,302,773 (GRCm39) missense probably damaging 1.00
R0928:Abca12 UTSW 1 71,388,333 (GRCm39) missense probably benign 0.06
R1036:Abca12 UTSW 1 71,302,569 (GRCm39) critical splice donor site probably null
R1086:Abca12 UTSW 1 71,334,220 (GRCm39) splice site probably benign
R1300:Abca12 UTSW 1 71,283,967 (GRCm39) missense probably damaging 1.00
R1337:Abca12 UTSW 1 71,333,978 (GRCm39) missense probably benign 0.03
R1356:Abca12 UTSW 1 71,342,112 (GRCm39) splice site probably benign
R1372:Abca12 UTSW 1 71,334,016 (GRCm39) missense probably damaging 1.00
R1434:Abca12 UTSW 1 71,348,959 (GRCm39) missense probably benign 0.00
R1580:Abca12 UTSW 1 71,305,124 (GRCm39) missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71,302,570 (GRCm39) critical splice donor site probably null
R1773:Abca12 UTSW 1 71,327,755 (GRCm39) missense probably damaging 1.00
R1829:Abca12 UTSW 1 71,334,188 (GRCm39) missense probably benign 0.26
R1922:Abca12 UTSW 1 71,359,083 (GRCm39) missense probably benign 0.10
R1927:Abca12 UTSW 1 71,283,999 (GRCm39) missense probably damaging 1.00
R2115:Abca12 UTSW 1 71,283,930 (GRCm39) missense probably benign 0.01
R2146:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2148:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2150:Abca12 UTSW 1 71,302,647 (GRCm39) missense probably benign 0.02
R2299:Abca12 UTSW 1 71,297,381 (GRCm39) missense probably damaging 1.00
R2392:Abca12 UTSW 1 71,297,264 (GRCm39) missense probably damaging 1.00
R2571:Abca12 UTSW 1 71,289,044 (GRCm39) missense probably benign 0.00
R3077:Abca12 UTSW 1 71,306,764 (GRCm39) missense probably benign 0.02
R3078:Abca12 UTSW 1 71,306,764 (GRCm39) missense probably benign 0.02
R3705:Abca12 UTSW 1 71,324,864 (GRCm39) missense probably damaging 1.00
R3800:Abca12 UTSW 1 71,305,046 (GRCm39) missense probably damaging 1.00
R3905:Abca12 UTSW 1 71,318,616 (GRCm39) missense probably benign 0.02
R3905:Abca12 UTSW 1 71,307,389 (GRCm39) missense possibly damaging 0.79
R3962:Abca12 UTSW 1 71,313,674 (GRCm39) splice site probably null
R4082:Abca12 UTSW 1 71,306,622 (GRCm39) missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71,359,030 (GRCm39) critical splice donor site probably null
R4214:Abca12 UTSW 1 71,327,856 (GRCm39) missense probably damaging 0.99
R4403:Abca12 UTSW 1 71,306,595 (GRCm39) missense probably damaging 1.00
R4524:Abca12 UTSW 1 71,342,076 (GRCm39) missense probably benign 0.19
R4615:Abca12 UTSW 1 71,369,493 (GRCm39) missense probably benign
R4617:Abca12 UTSW 1 71,369,493 (GRCm39) missense probably benign
R4714:Abca12 UTSW 1 71,360,609 (GRCm39) missense probably benign 0.00
R4809:Abca12 UTSW 1 71,318,015 (GRCm39) missense probably benign 0.10
R4810:Abca12 UTSW 1 71,342,771 (GRCm39) missense probably benign 0.00
R4825:Abca12 UTSW 1 71,341,844 (GRCm39) missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71,334,098 (GRCm39) missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71,303,926 (GRCm39) missense probably damaging 0.99
R5026:Abca12 UTSW 1 71,356,383 (GRCm39) missense probably benign 0.04
R5064:Abca12 UTSW 1 71,340,119 (GRCm39) missense probably damaging 1.00
R5188:Abca12 UTSW 1 71,330,651 (GRCm39) missense probably benign 0.23
R5234:Abca12 UTSW 1 71,302,823 (GRCm39) missense probably damaging 0.99
R5267:Abca12 UTSW 1 71,374,933 (GRCm39) splice site probably benign
R5302:Abca12 UTSW 1 71,323,111 (GRCm39) missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71,334,215 (GRCm39) missense probably damaging 1.00
R5451:Abca12 UTSW 1 71,334,076 (GRCm39) missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71,331,605 (GRCm39) missense probably benign 0.29
R5529:Abca12 UTSW 1 71,304,040 (GRCm39) missense probably damaging 1.00
R5615:Abca12 UTSW 1 71,346,218 (GRCm39) missense probably damaging 1.00
R5649:Abca12 UTSW 1 71,330,501 (GRCm39) missense probably damaging 1.00
R5800:Abca12 UTSW 1 71,360,591 (GRCm39) missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71,342,651 (GRCm39) missense probably damaging 1.00
R5878:Abca12 UTSW 1 71,385,792 (GRCm39) missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71,297,257 (GRCm39) missense probably damaging 1.00
R6280:Abca12 UTSW 1 71,311,619 (GRCm39) missense probably benign 0.04
R6316:Abca12 UTSW 1 71,353,118 (GRCm39) missense probably benign 0.01
R6337:Abca12 UTSW 1 71,334,172 (GRCm39) missense probably damaging 1.00
R6383:Abca12 UTSW 1 71,286,343 (GRCm39) missense probably benign 0.03
R6564:Abca12 UTSW 1 71,349,009 (GRCm39) missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71,297,384 (GRCm39) missense probably benign 0.00
R6756:Abca12 UTSW 1 71,298,512 (GRCm39) splice site probably null
R6876:Abca12 UTSW 1 71,302,667 (GRCm39) missense probably damaging 0.98
R6999:Abca12 UTSW 1 71,356,321 (GRCm39) nonsense probably null
R7145:Abca12 UTSW 1 71,346,212 (GRCm39) missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71,287,591 (GRCm39) missense probably damaging 0.99
R7285:Abca12 UTSW 1 71,388,314 (GRCm39) nonsense probably null
R7421:Abca12 UTSW 1 71,286,295 (GRCm39) nonsense probably null
R7531:Abca12 UTSW 1 71,286,332 (GRCm39) missense probably damaging 0.99
R7592:Abca12 UTSW 1 71,327,836 (GRCm39) missense probably benign 0.01
R7687:Abca12 UTSW 1 71,297,341 (GRCm39) missense probably benign 0.00
R7690:Abca12 UTSW 1 71,353,313 (GRCm39) missense probably benign 0.00
R7709:Abca12 UTSW 1 71,374,887 (GRCm39) missense probably benign 0.00
R7736:Abca12 UTSW 1 71,359,123 (GRCm39) missense probably benign 0.01
R7754:Abca12 UTSW 1 71,342,046 (GRCm39) missense probably benign
R7761:Abca12 UTSW 1 71,369,447 (GRCm39) missense probably damaging 1.00
R7808:Abca12 UTSW 1 71,313,793 (GRCm39) splice site probably null
R7816:Abca12 UTSW 1 71,331,588 (GRCm39) missense probably benign 0.01
R7821:Abca12 UTSW 1 71,298,950 (GRCm39) missense probably benign 0.12
R7827:Abca12 UTSW 1 71,453,837 (GRCm39) start gained probably benign
R7829:Abca12 UTSW 1 71,331,580 (GRCm39) missense probably benign 0.37
R7863:Abca12 UTSW 1 71,332,656 (GRCm39) missense probably damaging 0.96
R8053:Abca12 UTSW 1 71,388,328 (GRCm39) nonsense probably null
R8093:Abca12 UTSW 1 71,319,552 (GRCm39) missense probably benign 0.00
R8120:Abca12 UTSW 1 71,298,540 (GRCm39) missense possibly damaging 0.92
R8136:Abca12 UTSW 1 71,287,556 (GRCm39) missense probably benign 0.15
R8155:Abca12 UTSW 1 71,330,497 (GRCm39) missense probably damaging 1.00
R8189:Abca12 UTSW 1 71,324,885 (GRCm39) missense probably damaging 1.00
R8233:Abca12 UTSW 1 71,390,916 (GRCm39) missense probably benign 0.00
R8249:Abca12 UTSW 1 71,360,971 (GRCm39) missense probably benign 0.00
R8255:Abca12 UTSW 1 71,359,058 (GRCm39) missense probably benign 0.13
R8300:Abca12 UTSW 1 71,353,123 (GRCm39) missense possibly damaging 0.77
R8339:Abca12 UTSW 1 71,324,831 (GRCm39) missense probably damaging 1.00
R8490:Abca12 UTSW 1 71,323,256 (GRCm39) missense probably damaging 1.00
R8494:Abca12 UTSW 1 71,327,821 (GRCm39) missense probably benign 0.02
R8527:Abca12 UTSW 1 71,349,047 (GRCm39) critical splice acceptor site probably null
R8542:Abca12 UTSW 1 71,349,047 (GRCm39) critical splice acceptor site probably null
R8692:Abca12 UTSW 1 71,327,874 (GRCm39) missense probably damaging 0.96
R8723:Abca12 UTSW 1 71,360,897 (GRCm39) missense probably benign 0.04
R8796:Abca12 UTSW 1 71,297,248 (GRCm39) critical splice donor site probably benign
R8911:Abca12 UTSW 1 71,380,690 (GRCm39) missense probably benign 0.07
R8913:Abca12 UTSW 1 71,303,972 (GRCm39) missense probably damaging 1.00
R8957:Abca12 UTSW 1 71,360,784 (GRCm39) missense possibly damaging 0.90
R9000:Abca12 UTSW 1 71,353,195 (GRCm39) missense probably damaging 1.00
R9137:Abca12 UTSW 1 71,298,525 (GRCm39) missense possibly damaging 0.80
R9228:Abca12 UTSW 1 71,332,599 (GRCm39) missense probably damaging 1.00
R9237:Abca12 UTSW 1 71,318,557 (GRCm39) missense probably damaging 0.97
R9299:Abca12 UTSW 1 71,359,042 (GRCm39) missense possibly damaging 0.48
R9419:Abca12 UTSW 1 71,342,649 (GRCm39) missense possibly damaging 0.81
R9492:Abca12 UTSW 1 71,297,380 (GRCm39) missense possibly damaging 0.81
R9538:Abca12 UTSW 1 71,380,672 (GRCm39) missense probably benign 0.04
R9585:Abca12 UTSW 1 71,342,745 (GRCm39) missense probably damaging 1.00
R9658:Abca12 UTSW 1 71,325,634 (GRCm39) missense probably damaging 0.97
R9763:Abca12 UTSW 1 71,302,717 (GRCm39) missense possibly damaging 0.84
X0013:Abca12 UTSW 1 71,287,592 (GRCm39) missense probably damaging 0.99
X0018:Abca12 UTSW 1 71,353,669 (GRCm39) missense probably benign
X0063:Abca12 UTSW 1 71,388,223 (GRCm39) missense probably benign 0.15
X0065:Abca12 UTSW 1 71,380,620 (GRCm39) critical splice donor site probably null
Z1176:Abca12 UTSW 1 71,323,229 (GRCm39) missense probably damaging 1.00
Z1177:Abca12 UTSW 1 71,331,690 (GRCm39) missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71,321,970 (GRCm39) missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71,315,241 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTAGCATGTTTTAAGAGGCTC -3'
(R):5'- GGAATCCTAAAACTGCATTTGGTTC -3'

Sequencing Primer
(F):5'- CTAGCATGTTTTAAGAGGCTCTAAGG -3'
(R):5'- CTCTTGTTTCAGACGCTAGAAC -3'
Posted On 2014-10-01