Incidental Mutation 'R2149:Gfm1'
ID 234078
Institutional Source Beutler Lab
Gene Symbol Gfm1
Ensembl Gene ENSMUSG00000027774
Gene Name G elongation factor, mitochondrial 1
Synonyms D3Wsu133e
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 67337448-67382401 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67381893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 693 (L693P)
Ref Sequence ENSEMBL: ENSMUSP00000076503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054825] [ENSMUST00000077271]
AlphaFold Q8K0D5
Predicted Effect probably benign
Transcript: ENSMUST00000054825
SMART Domains Protein: ENSMUSP00000056728
Gene: ENSMUSG00000049404

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Pfam:Latexin 81 299 8e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077271
AA Change: L693P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774
AA Change: L693P

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195639
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Gfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Gfm1 APN 3 67,345,893 (GRCm39) missense possibly damaging 0.79
IGL01377:Gfm1 APN 3 67,382,086 (GRCm39) missense probably damaging 1.00
IGL01397:Gfm1 APN 3 67,350,991 (GRCm39) missense probably benign 0.09
IGL01738:Gfm1 APN 3 67,363,994 (GRCm39) missense probably benign 0.15
IGL02679:Gfm1 APN 3 67,382,100 (GRCm39) missense possibly damaging 0.56
IGL03271:Gfm1 APN 3 67,382,076 (GRCm39) missense probably damaging 1.00
R0389:Gfm1 UTSW 3 67,365,251 (GRCm39) missense probably benign 0.00
R0815:Gfm1 UTSW 3 67,381,928 (GRCm39) missense probably damaging 1.00
R0863:Gfm1 UTSW 3 67,381,928 (GRCm39) missense probably damaging 1.00
R1626:Gfm1 UTSW 3 67,345,977 (GRCm39) missense probably damaging 1.00
R1843:Gfm1 UTSW 3 67,342,943 (GRCm39) missense probably damaging 1.00
R1931:Gfm1 UTSW 3 67,363,918 (GRCm39) missense probably benign 0.44
R2097:Gfm1 UTSW 3 67,357,079 (GRCm39) missense probably damaging 0.97
R2337:Gfm1 UTSW 3 67,342,847 (GRCm39) missense probably damaging 1.00
R3739:Gfm1 UTSW 3 67,364,033 (GRCm39) missense probably damaging 1.00
R4193:Gfm1 UTSW 3 67,339,053 (GRCm39) missense probably damaging 1.00
R4661:Gfm1 UTSW 3 67,340,731 (GRCm39) missense probably damaging 1.00
R5023:Gfm1 UTSW 3 67,380,877 (GRCm39) missense probably damaging 1.00
R5057:Gfm1 UTSW 3 67,380,877 (GRCm39) missense probably damaging 1.00
R5503:Gfm1 UTSW 3 67,361,060 (GRCm39) critical splice donor site probably null
R5692:Gfm1 UTSW 3 67,342,955 (GRCm39) missense probably damaging 1.00
R5771:Gfm1 UTSW 3 67,342,895 (GRCm39) missense probably benign 0.11
R6232:Gfm1 UTSW 3 67,375,215 (GRCm39) missense possibly damaging 0.52
R6234:Gfm1 UTSW 3 67,342,847 (GRCm39) missense probably damaging 1.00
R6514:Gfm1 UTSW 3 67,380,879 (GRCm39) missense probably benign
R6911:Gfm1 UTSW 3 67,358,636 (GRCm39) missense possibly damaging 0.83
R7295:Gfm1 UTSW 3 67,347,514 (GRCm39) missense probably benign 0.30
R7899:Gfm1 UTSW 3 67,380,860 (GRCm39) missense probably benign 0.10
R8321:Gfm1 UTSW 3 67,337,594 (GRCm39) missense probably benign
R8465:Gfm1 UTSW 3 67,339,032 (GRCm39) missense probably damaging 1.00
R8473:Gfm1 UTSW 3 67,361,051 (GRCm39) missense possibly damaging 0.71
R9745:Gfm1 UTSW 3 67,358,657 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGAATGTGTGAACTGGACGTAC -3'
(R):5'- ACCTGCAGTACTCCATCGTG -3'

Sequencing Primer
(F):5'- ATGTGTGAACTGGACGTACTATAG -3'
(R):5'- GCAGTACTCCATCGTGTACTC -3'
Posted On 2014-10-01