Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:Dsel'

23408

Institutional Source

Beutler Lab

Gene Symbol

Dsel

Ensembl Gene

ENSMUSG00000038702

Gene Name

dermatan sulfate epimerase-like

Synonyms

9330132E09Rik, DS-epi2

MMRRC Submission

038455-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R0196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111858702-111864918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 111861603 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 401 (T401P)

Ref Sequence

ENSEMBL: ENSMUSP00000043570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035462]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035462
AA Change: T401P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: T401P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
transmembrane domain	769	791	N/A	INTRINSIC
transmembrane domain	798	817	N/A	INTRINSIC
Pfam:Sulfotransfer_1	847	1201	2.1e-12	PFAM
Pfam:Sulfotransfer_3	848	1143	1.7e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186365

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189370

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189731

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Dsel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Dsel	APN	1	111860061	nonsense	probably null
IGL01562:Dsel	APN	1	111860319	missense	probably benign
IGL01591:Dsel	APN	1	111859695	missense	probably benign	0.08
IGL01822:Dsel	APN	1	111861896	missense	probably damaging	1.00
IGL02289:Dsel	APN	1	111860102	nonsense	probably null
IGL02557:Dsel	APN	1	111862570	missense	probably damaging	1.00
IGL02805:Dsel	APN	1	111862316	missense	probably damaging	1.00
IGL02864:Dsel	APN	1	111859214	missense	probably damaging	1.00
IGL02887:Dsel	APN	1	111860732	missense	possibly damaging	0.90
IGL03092:Dsel	APN	1	111860063	missense	probably damaging	1.00
IGL03117:Dsel	APN	1	111859178	utr 3 prime	probably benign
IGL03182:Dsel	APN	1	111860138	missense	probably damaging	0.99
rudolph	UTSW	1	111859817	missense	probably damaging	0.99
R0465:Dsel	UTSW	1	111862262	missense	probably benign	0.00
R0725:Dsel	UTSW	1	111859952	missense	possibly damaging	0.79
R1024:Dsel	UTSW	1	111860673	missense	probably damaging	1.00
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1147:Dsel	UTSW	1	111862209	missense	possibly damaging	0.71
R1654:Dsel	UTSW	1	111862512	missense	probably damaging	1.00
R1728:Dsel	UTSW	1	111859457	missense	probably benign
R1728:Dsel	UTSW	1	111859994	missense	probably benign
R1729:Dsel	UTSW	1	111859457	missense	probably benign
R1729:Dsel	UTSW	1	111859994	missense	probably benign
R1730:Dsel	UTSW	1	111859457	missense	probably benign
R1730:Dsel	UTSW	1	111859994	missense	probably benign
R1735:Dsel	UTSW	1	111860915	missense	probably damaging	1.00
R1739:Dsel	UTSW	1	111859457	missense	probably benign
R1739:Dsel	UTSW	1	111859994	missense	probably benign
R1762:Dsel	UTSW	1	111859457	missense	probably benign
R1762:Dsel	UTSW	1	111859994	missense	probably benign
R1783:Dsel	UTSW	1	111859457	missense	probably benign
R1783:Dsel	UTSW	1	111859994	missense	probably benign
R1785:Dsel	UTSW	1	111859457	missense	probably benign
R1785:Dsel	UTSW	1	111859994	missense	probably benign
R2049:Dsel	UTSW	1	111859457	missense	probably benign
R2080:Dsel	UTSW	1	111859962	missense	probably benign
R2141:Dsel	UTSW	1	111859457	missense	probably benign
R2142:Dsel	UTSW	1	111859457	missense	probably benign
R2150:Dsel	UTSW	1	111860257	missense	probably benign	0.04
R4324:Dsel	UTSW	1	111861393	missense	probably damaging	1.00
R5378:Dsel	UTSW	1	111862821	start gained	probably benign
R5881:Dsel	UTSW	1	111859438	missense	probably damaging	1.00
R5919:Dsel	UTSW	1	111860253	missense	probably benign
R6820:Dsel	UTSW	1	111859817	missense	probably damaging	0.99
R7003:Dsel	UTSW	1	111860295	missense	probably benign
R7064:Dsel	UTSW	1	111862847	start gained	probably benign
R7297:Dsel	UTSW	1	111861776	missense	probably damaging	1.00
R7340:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7341:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7343:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7346:Dsel	UTSW	1	111861068	missense	probably damaging	1.00
R7347:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7365:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7366:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7367:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
R7393:Dsel	UTSW	1	111861573	missense	probably damaging	1.00
X0057:Dsel	UTSW	1	111859210	missense	probably benign
Z1177:Dsel	UTSW	1	111861716	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGAATACCTGCCCATTAGGAGCG -3'
(R):5'- GGTTTTATGGTCCAGAGAGCCAGC -3'

Sequencing Primer
(F):5'- CATGTCCTGGGTTAAAGCTTC -3'
(R):5'- GACCAATGGTTCCTTCCACT -3'

Posted On

2013-04-16