Incidental Mutation 'R2149:Setd1a'
ID 234108
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127385690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 256 (V256D)
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000047075
AA Change: V799D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: V799D

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
AA Change: V799D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: V799D

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154987
AA Change: V256D

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCCCTATGCTCTGTACACAC -3'
(R):5'- GTCCCTACTTTGAATTGGGCAAC -3'

Sequencing Primer
(F):5'- TATGCTCTGTACACACAAGGG -3'
(R):5'- GGCAACCTCTTTCAGCAAAC -3'
Posted On 2014-10-01