Mutagenetix > Incidental Mutation

Incidental Mutation 'R2149:Muc2'

234111

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

040152-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R2149 (G1)

Quality Score

171

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CGTG to CGTGTG at 141699185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185406

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

probably benign
Transcript: ENSMUST00000191587

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	A	G	1: 43,742,336	D126G	probably damaging	Het
1700006A11Rik	T	C	3: 124,409,686	E414G	probably benign	Het
3632451O06Rik	T	C	14: 49,751,571	D647G	probably benign	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Abca13	A	G	11: 9,267,508	T317A	possibly damaging	Het
Acap3	T	G	4: 155,905,625	L750R	probably damaging	Het
Anapc7	T	A	5: 122,443,826	S511T	probably benign	Het
Anp32a	T	A	9: 62,371,802	F46Y	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arid2	T	C	15: 96,370,835	I943T	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC003331	A	T	1: 150,388,559	N66K	probably benign	Het
Btnl6	T	C	17: 34,514,347	N218S	possibly damaging	Het
Capn11	T	C	17: 45,633,107		probably null	Het
Clcnkb	C	T	4: 141,408,017	G470D	probably damaging	Het
Clic6	T	A	16: 92,499,207	S252T	probably benign	Het
Col28a1	T	C	6: 8,155,383	K318E	possibly damaging	Het
Col5a3	A	T	9: 20,771,270	V1626D	unknown	Het
Col6a4	C	A	9: 106,076,929	A404S	probably benign	Het
Cyp2j5	G	T	4: 96,641,340	H265N	possibly damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dock2	A	G	11: 34,229,472		probably null	Het
Emilin2	T	C	17: 71,273,992	S580G	probably benign	Het
Fbn2	C	A	18: 58,102,325		probably null	Het
Gfm1	T	C	3: 67,474,560	L693P	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gpha2	A	G	19: 6,226,982	T38A	probably damaging	Het
Gtf2h3	T	C	5: 124,599,785		probably benign	Het
Hmgxb3	T	C	18: 61,157,674	T376A	probably benign	Het
Hspa12b	A	G	2: 131,143,057	D416G	probably damaging	Het
Immt	C	T	6: 71,844,675	R28*	probably null	Het
Iqgap1	T	C	7: 80,762,560	Y180C	probably damaging	Het
Kcnq3	T	A	15: 66,023,729	D322V	probably damaging	Het
Kifc2	C	A	15: 76,662,221	L268I	probably benign	Het
Lama1	T	C	17: 67,773,865	M1296T	possibly damaging	Het
Lipk	A	G	19: 34,021,617	N104S	possibly damaging	Het
Lrrc14b	T	A	13: 74,363,757	N68I	possibly damaging	Het
Lrrc28	A	T	7: 67,531,682	D268E	probably damaging	Het
Ly6c2	T	C	15: 75,108,543	*132W	probably null	Het
Msh6	A	G	17: 87,986,088	E757G	probably damaging	Het
Mtss1l	T	C	8: 110,726,383	V47A	possibly damaging	Het
Nalcn	A	T	14: 123,370,017	I680N	probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1501	A	C	19: 13,838,582	V197G	probably damaging	Het
Olfr61	C	T	7: 140,638,052	T117M	probably damaging	Het
Olfr713	A	T	7: 107,036,338	Y61F	possibly damaging	Het
Olfr912	T	C	9: 38,581,508	V77A	probably benign	Het
Oosp2	A	T	19: 11,649,614	L17*	probably null	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pde4dip	T	A	3: 97,792,836	Q300L	possibly damaging	Het
Phf2	T	C	13: 48,804,689	K950E	unknown	Het
Pira2	G	A	7: 3,844,171	P124L	probably damaging	Het
Plpp4	C	T	7: 129,379,371	T157I	probably benign	Het
Polrmt	G	A	10: 79,740,275	Q545*	probably null	Het
Ptprs	A	G	17: 56,417,706	F1511L	probably damaging	Het
Sbno1	T	C	5: 124,402,119		probably null	Het
Setd1a	T	A	7: 127,786,518	V256D	possibly damaging	Het
Slamf1	T	C	1: 171,767,272	S16P	probably damaging	Het
Slc16a14	T	C	1: 84,907,399	D473G	probably damaging	Het
Slc8a2	A	T	7: 16,159,164	H917L	probably damaging	Het
Sorbs2	A	C	8: 45,795,443	D442A	probably damaging	Het
Srp68	G	T	11: 116,260,867	T301K	possibly damaging	Het
Stab2	A	T	10: 86,865,040	C457*	probably null	Het
Stk31	T	G	6: 49,439,218	S652R	possibly damaging	Het
Stra6	T	G	9: 58,152,539	S594R	probably benign	Het
Tbc1d9	G	A	8: 83,271,449	E1212K	probably damaging	Het
Thada	C	T	17: 84,441,764	R593Q	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tmem132c	T	A	5: 127,462,962	W351R	probably damaging	Het
Tmem206	T	G	1: 191,345,109	F210V	probably benign	Het
Trim10	C	T	17: 36,877,014	A374V	probably benign	Het
Try10	T	C	6: 41,356,561	V80A	probably benign	Het
Ttn	T	C	2: 76,729,363	T29565A	possibly damaging	Het
Uggt2	G	T	14: 119,075,345	Q351K	probably benign	Het
Vmn1r120	A	T	7: 21,052,964	V274D	probably damaging	Het
Vmn1r62	A	T	7: 5,675,359	H13L	probably benign	Het
Vmn2r101	C	T	17: 19,588,963	T118I	probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Wnt5a	A	G	14: 28,513,317	Y86C	probably damaging	Het
Xpa	T	C	4: 46,183,189	E200G	probably damaging	Het
Zc3h12a	C	T	4: 125,126,642	R136K	possibly damaging	Het
Zc3hav1	T	C	6: 38,336,537	H191R	probably damaging	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- CCCCATGTGTATGTGCATGTG -3'
(R):5'- AGCTTGGGAAGATCCTGAGG -3'

Sequencing Primer
(F):5'- gcatgtgtgtgtgtgtgt -3'
(R):5'- ATCCACGGGACCTGTGTAG -3'

Posted On

2014-10-01