Incidental Mutation 'R2149:Sorbs2'
ID 234112
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Name sorbin and SH3 domain containing 2
Synonyms 2010203O03Rik, 9430041O17Rik
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 45960825-46280943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 46248480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 442 (D442A)
Ref Sequence ENSEMBL: ENSMUSP00000070720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000171337] [ENSMUST00000211095] [ENSMUST00000139869] [ENSMUST00000153798]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067065
AA Change: D442A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: D442A

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067107
AA Change: D558A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: D558A

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125295
AA Change: D497A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: D497A

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect possibly damaging
Transcript: ENSMUST00000135336
AA Change: D558A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: D558A

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171337
AA Change: D577A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: D577A

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 46,252,743 (GRCm39) splice site probably null
IGL00964:Sorbs2 APN 8 46,248,714 (GRCm39) missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 46,198,460 (GRCm39) missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 46,248,631 (GRCm39) missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 46,248,381 (GRCm39) missense probably null
IGL01662:Sorbs2 APN 8 46,256,866 (GRCm39) splice site probably benign
IGL01970:Sorbs2 APN 8 46,198,840 (GRCm39) missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 46,276,786 (GRCm39) missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 46,256,877 (GRCm39) missense probably benign 0.00
IGL03036:Sorbs2 APN 8 46,235,902 (GRCm39) missense probably benign
IGL03151:Sorbs2 APN 8 46,252,750 (GRCm39) missense probably benign 0.01
IGL03164:Sorbs2 APN 8 46,235,911 (GRCm39) missense probably benign 0.01
IGL03350:Sorbs2 APN 8 46,258,844 (GRCm39) missense probably damaging 0.99
BB001:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
BB011:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,249,300 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,238,291 (GRCm39) splice site probably null
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 46,238,374 (GRCm39) splice site probably benign
R0306:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R0308:Sorbs2 UTSW 8 46,248,167 (GRCm39) nonsense probably null
R0638:Sorbs2 UTSW 8 46,249,347 (GRCm39) missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 46,249,539 (GRCm39) missense probably benign 0.39
R1110:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.13
R1160:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 46,248,656 (GRCm39) missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 46,249,004 (GRCm39) missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 46,243,000 (GRCm39) splice site probably benign
R1514:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 46,212,234 (GRCm39) splice site probably benign
R1582:Sorbs2 UTSW 8 46,258,814 (GRCm39) missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 46,222,891 (GRCm39) missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 46,254,021 (GRCm39) missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 46,216,056 (GRCm39) makesense probably null
R1766:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 46,258,733 (GRCm39) missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 46,249,389 (GRCm39) missense probably benign 0.01
R1954:Sorbs2 UTSW 8 46,198,775 (GRCm39) missense probably benign 0.23
R2060:Sorbs2 UTSW 8 46,228,666 (GRCm39) missense probably damaging 1.00
R2568:Sorbs2 UTSW 8 46,248,407 (GRCm39) nonsense probably null
R3812:Sorbs2 UTSW 8 46,216,067 (GRCm39) missense probably benign 0.00
R3831:Sorbs2 UTSW 8 46,248,132 (GRCm39) missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 46,225,747 (GRCm39) critical splice donor site probably null
R4033:Sorbs2 UTSW 8 46,228,632 (GRCm39) missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 46,248,330 (GRCm39) missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 46,194,652 (GRCm39) intron probably benign
R4926:Sorbs2 UTSW 8 46,249,254 (GRCm39) missense probably benign 0.03
R5027:Sorbs2 UTSW 8 46,199,571 (GRCm39) splice site probably null
R5118:Sorbs2 UTSW 8 46,248,822 (GRCm39) missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R5342:Sorbs2 UTSW 8 46,249,050 (GRCm39) missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 46,272,778 (GRCm39) missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 46,249,038 (GRCm39) missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 46,194,618 (GRCm39) critical splice donor site probably null
R5687:Sorbs2 UTSW 8 46,228,669 (GRCm39) missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 46,245,912 (GRCm39) missense probably benign 0.27
R5733:Sorbs2 UTSW 8 46,212,226 (GRCm39) missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 46,216,220 (GRCm39) missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 46,222,934 (GRCm39) critical splice donor site probably null
R6341:Sorbs2 UTSW 8 46,223,615 (GRCm39) missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 46,249,213 (GRCm39) missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 46,225,651 (GRCm39) missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 46,248,860 (GRCm39) nonsense probably null
R7404:Sorbs2 UTSW 8 46,212,233 (GRCm39) splice site probably null
R7524:Sorbs2 UTSW 8 46,248,693 (GRCm39) missense probably benign 0.00
R7809:Sorbs2 UTSW 8 46,198,465 (GRCm39) missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 46,249,593 (GRCm39) missense probably null 0.16
R7924:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R8285:Sorbs2 UTSW 8 46,249,104 (GRCm39) missense probably damaging 0.98
R8696:Sorbs2 UTSW 8 46,248,686 (GRCm39) missense possibly damaging 0.95
R8927:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R8928:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R9005:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9006:Sorbs2 UTSW 8 46,258,858 (GRCm39) missense possibly damaging 0.95
R9016:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9017:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9091:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9196:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9256:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9282:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9283:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9384:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9624:Sorbs2 UTSW 8 46,228,690 (GRCm39) missense possibly damaging 0.89
R9664:Sorbs2 UTSW 8 46,276,788 (GRCm39) missense probably benign 0.05
Z1176:Sorbs2 UTSW 8 46,243,062 (GRCm39) missense probably null 0.96
Z1177:Sorbs2 UTSW 8 46,235,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAATGACGACTGCGACAGC -3'
(R):5'- AGACTTCGACTTCTGAATCAGC -3'

Sequencing Primer
(F):5'- CCAAGTCAGAGAGTATGGGTTCTC -3'
(R):5'- CTTTTCAAATTCCGAAATGCGAGTGG -3'
Posted On 2014-10-01