Mutagenetix > Incidental Mutation

Incidental Mutation 'R2149:Sorbs2'

234112

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

040152-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2149 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 45795443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 442 (D442A)

Ref Sequence

ENSEMBL: ENSMUSP00000070720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000067065
AA Change: D442A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: D442A

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067107
AA Change: D558A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: D558A

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125295
AA Change: D497A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: D497A

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135116

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135336
AA Change: D558A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: D558A

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138049

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139869

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153798

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155858

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171337
AA Change: D577A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: D577A

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	A	G	1: 43,742,336	D126G	probably damaging	Het
1700006A11Rik	T	C	3: 124,409,686	E414G	probably benign	Het
3632451O06Rik	T	C	14: 49,751,571	D647G	probably benign	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Abca13	A	G	11: 9,267,508	T317A	possibly damaging	Het
Acap3	T	G	4: 155,905,625	L750R	probably damaging	Het
Anapc7	T	A	5: 122,443,826	S511T	probably benign	Het
Anp32a	T	A	9: 62,371,802	F46Y	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arid2	T	C	15: 96,370,835	I943T	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC003331	A	T	1: 150,388,559	N66K	probably benign	Het
Btnl6	T	C	17: 34,514,347	N218S	possibly damaging	Het
Capn11	T	C	17: 45,633,107		probably null	Het
Clcnkb	C	T	4: 141,408,017	G470D	probably damaging	Het
Clic6	T	A	16: 92,499,207	S252T	probably benign	Het
Col28a1	T	C	6: 8,155,383	K318E	possibly damaging	Het
Col5a3	A	T	9: 20,771,270	V1626D	unknown	Het
Col6a4	C	A	9: 106,076,929	A404S	probably benign	Het
Cyp2j5	G	T	4: 96,641,340	H265N	possibly damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dock2	A	G	11: 34,229,472		probably null	Het
Emilin2	T	C	17: 71,273,992	S580G	probably benign	Het
Fbn2	C	A	18: 58,102,325		probably null	Het
Gfm1	T	C	3: 67,474,560	L693P	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gpha2	A	G	19: 6,226,982	T38A	probably damaging	Het
Gtf2h3	T	C	5: 124,599,785		probably benign	Het
Hmgxb3	T	C	18: 61,157,674	T376A	probably benign	Het
Hspa12b	A	G	2: 131,143,057	D416G	probably damaging	Het
Immt	C	T	6: 71,844,675	R28*	probably null	Het
Iqgap1	T	C	7: 80,762,560	Y180C	probably damaging	Het
Kcnq3	T	A	15: 66,023,729	D322V	probably damaging	Het
Kifc2	C	A	15: 76,662,221	L268I	probably benign	Het
Lama1	T	C	17: 67,773,865	M1296T	possibly damaging	Het
Lipk	A	G	19: 34,021,617	N104S	possibly damaging	Het
Lrrc14b	T	A	13: 74,363,757	N68I	possibly damaging	Het
Lrrc28	A	T	7: 67,531,682	D268E	probably damaging	Het
Ly6c2	T	C	15: 75,108,543	*132W	probably null	Het
Msh6	A	G	17: 87,986,088	E757G	probably damaging	Het
Mtss1l	T	C	8: 110,726,383	V47A	possibly damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Nalcn	A	T	14: 123,370,017	I680N	probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1501	A	C	19: 13,838,582	V197G	probably damaging	Het
Olfr61	C	T	7: 140,638,052	T117M	probably damaging	Het
Olfr713	A	T	7: 107,036,338	Y61F	possibly damaging	Het
Olfr912	T	C	9: 38,581,508	V77A	probably benign	Het
Oosp2	A	T	19: 11,649,614	L17*	probably null	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pde4dip	T	A	3: 97,792,836	Q300L	possibly damaging	Het
Phf2	T	C	13: 48,804,689	K950E	unknown	Het
Pira2	G	A	7: 3,844,171	P124L	probably damaging	Het
Plpp4	C	T	7: 129,379,371	T157I	probably benign	Het
Polrmt	G	A	10: 79,740,275	Q545*	probably null	Het
Ptprs	A	G	17: 56,417,706	F1511L	probably damaging	Het
Sbno1	T	C	5: 124,402,119		probably null	Het
Setd1a	T	A	7: 127,786,518	V256D	possibly damaging	Het
Slamf1	T	C	1: 171,767,272	S16P	probably damaging	Het
Slc16a14	T	C	1: 84,907,399	D473G	probably damaging	Het
Slc8a2	A	T	7: 16,159,164	H917L	probably damaging	Het
Srp68	G	T	11: 116,260,867	T301K	possibly damaging	Het
Stab2	A	T	10: 86,865,040	C457*	probably null	Het
Stk31	T	G	6: 49,439,218	S652R	possibly damaging	Het
Stra6	T	G	9: 58,152,539	S594R	probably benign	Het
Tbc1d9	G	A	8: 83,271,449	E1212K	probably damaging	Het
Thada	C	T	17: 84,441,764	R593Q	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tmem132c	T	A	5: 127,462,962	W351R	probably damaging	Het
Tmem206	T	G	1: 191,345,109	F210V	probably benign	Het
Trim10	C	T	17: 36,877,014	A374V	probably benign	Het
Try10	T	C	6: 41,356,561	V80A	probably benign	Het
Ttn	T	C	2: 76,729,363	T29565A	possibly damaging	Het
Uggt2	G	T	14: 119,075,345	Q351K	probably benign	Het
Vmn1r120	A	T	7: 21,052,964	V274D	probably damaging	Het
Vmn1r62	A	T	7: 5,675,359	H13L	probably benign	Het
Vmn2r101	C	T	17: 19,588,963	T118I	probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Wnt5a	A	G	14: 28,513,317	Y86C	probably damaging	Het
Xpa	T	C	4: 46,183,189	E200G	probably damaging	Het
Zc3h12a	C	T	4: 125,126,642	R136K	possibly damaging	Het
Zc3hav1	T	C	6: 38,336,537	H191R	probably damaging	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
BB001:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
BB011:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R0058:Sorbs2	UTSW	8	45785254	splice site	probably null
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0308:Sorbs2	UTSW	8	45795130	nonsense	probably null
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1110:Sorbs2	UTSW	8	45795730	missense	probably benign	0.13
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1440:Sorbs2	UTSW	8	45789963	splice site	probably benign
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4033:Sorbs2	UTSW	8	45775595	missense	probably damaging	1.00
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	splice site	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16
R7924:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R8285:Sorbs2	UTSW	8	45796067	missense	probably damaging	0.98
R8696:Sorbs2	UTSW	8	45795649	missense	possibly damaging	0.95
R8927:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R8928:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R9005:Sorbs2	UTSW	8	45795737	missense	probably benign
R9006:Sorbs2	UTSW	8	45805821	missense	possibly damaging	0.95
R9016:Sorbs2	UTSW	8	45795737	missense	probably benign
R9017:Sorbs2	UTSW	8	45795737	missense	probably benign
R9091:Sorbs2	UTSW	8	45795737	missense	probably benign
R9196:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9256:Sorbs2	UTSW	8	45795737	missense	probably benign
R9282:Sorbs2	UTSW	8	45795737	missense	probably benign
R9283:Sorbs2	UTSW	8	45795737	missense	probably benign
R9384:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9624:Sorbs2	UTSW	8	45775653	missense	possibly damaging	0.89
R9664:Sorbs2	UTSW	8	45823751	missense	probably benign	0.05
Z1176:Sorbs2	UTSW	8	45790025	missense	probably null	0.96
Z1177:Sorbs2	UTSW	8	45782959	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAATGACGACTGCGACAGC -3'
(R):5'- AGACTTCGACTTCTGAATCAGC -3'

Sequencing Primer
(F):5'- CCAAGTCAGAGAGTATGGGTTCTC -3'
(R):5'- CTTTTCAAATTCCGAAATGCGAGTGG -3'

Posted On

2014-10-01