Incidental Mutation 'R2149:Col6a4'
ID 234121
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Name collagen, type VI, alpha 4
Synonyms Vwa6, EG235580, 1110001D15Rik, Dvwa
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2149 (G1)
Quality Score 213
Status Not validated
Chromosome 9
Chromosomal Location 105866653-105973982 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105954128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 404 (A404S)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
AlphaFold A2AX52
Predicted Effect probably benign
Transcript: ENSMUST00000121963
AA Change: A404S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: A404S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137847
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 105,900,095 (GRCm39) missense probably benign 0.00
IGL00691:Col6a4 APN 9 105,934,606 (GRCm39) missense probably damaging 1.00
IGL01508:Col6a4 APN 9 105,890,804 (GRCm39) missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 105,945,397 (GRCm39) missense probably damaging 1.00
IGL01610:Col6a4 APN 9 105,924,906 (GRCm39) splice site probably benign
IGL01813:Col6a4 APN 9 105,954,452 (GRCm39) missense probably damaging 1.00
IGL01933:Col6a4 APN 9 105,937,313 (GRCm39) missense probably benign 0.04
IGL01973:Col6a4 APN 9 105,940,093 (GRCm39) missense probably damaging 1.00
IGL02053:Col6a4 APN 9 105,940,294 (GRCm39) missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 105,934,617 (GRCm39) missense probably benign 0.01
IGL02065:Col6a4 APN 9 105,954,302 (GRCm39) missense probably damaging 0.99
IGL02106:Col6a4 APN 9 105,940,304 (GRCm39) missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 105,940,141 (GRCm39) missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 105,945,277 (GRCm39) missense probably benign
IGL02234:Col6a4 APN 9 105,890,631 (GRCm39) missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 105,943,931 (GRCm39) missense probably benign 0.04
IGL02314:Col6a4 APN 9 105,874,355 (GRCm39) missense probably damaging 0.99
IGL03065:Col6a4 APN 9 105,918,363 (GRCm39) splice site probably benign
IGL03086:Col6a4 APN 9 105,960,061 (GRCm39) splice site probably benign
IGL03185:Col6a4 APN 9 105,896,653 (GRCm39) missense probably damaging 0.97
R0092:Col6a4 UTSW 9 105,890,513 (GRCm39) missense probably benign 0.04
R0095:Col6a4 UTSW 9 105,952,555 (GRCm39) missense probably benign 0.03
R0230:Col6a4 UTSW 9 105,949,565 (GRCm39) missense probably benign 0.11
R0359:Col6a4 UTSW 9 105,874,345 (GRCm39) missense probably benign
R0415:Col6a4 UTSW 9 105,952,279 (GRCm39) missense probably damaging 0.99
R0433:Col6a4 UTSW 9 105,945,193 (GRCm39) missense probably damaging 0.99
R0450:Col6a4 UTSW 9 105,957,746 (GRCm39) missense probably damaging 1.00
R0469:Col6a4 UTSW 9 105,957,746 (GRCm39) missense probably damaging 1.00
R0490:Col6a4 UTSW 9 105,890,969 (GRCm39) missense probably damaging 0.99
R0621:Col6a4 UTSW 9 105,943,990 (GRCm39) missense probably damaging 0.97
R0667:Col6a4 UTSW 9 105,907,158 (GRCm39) splice site probably benign
R0681:Col6a4 UTSW 9 105,944,343 (GRCm39) nonsense probably null
R0690:Col6a4 UTSW 9 105,905,386 (GRCm39) splice site probably benign
R0714:Col6a4 UTSW 9 105,895,102 (GRCm39) unclassified probably benign
R0788:Col6a4 UTSW 9 105,949,197 (GRCm39) missense probably benign 0.15
R1036:Col6a4 UTSW 9 105,945,397 (GRCm39) missense probably damaging 1.00
R1296:Col6a4 UTSW 9 105,940,052 (GRCm39) missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 105,940,144 (GRCm39) missense probably benign 0.15
R1484:Col6a4 UTSW 9 105,890,501 (GRCm39) critical splice donor site probably null
R1528:Col6a4 UTSW 9 105,952,419 (GRCm39) missense probably damaging 0.99
R1555:Col6a4 UTSW 9 105,878,085 (GRCm39) missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105,874,334 (GRCm39) missense probably benign 0.01
R1653:Col6a4 UTSW 9 105,949,608 (GRCm39) missense probably damaging 0.99
R1720:Col6a4 UTSW 9 105,903,671 (GRCm39) missense probably damaging 1.00
R1768:Col6a4 UTSW 9 105,957,299 (GRCm39) missense probably benign
R1941:Col6a4 UTSW 9 105,952,209 (GRCm39) missense probably benign 0.00
R2092:Col6a4 UTSW 9 105,937,530 (GRCm39) missense probably damaging 1.00
R2134:Col6a4 UTSW 9 105,943,860 (GRCm39) missense probably benign 0.09
R2174:Col6a4 UTSW 9 105,937,331 (GRCm39) missense probably damaging 0.98
R2204:Col6a4 UTSW 9 105,937,331 (GRCm39) missense probably damaging 0.98
R2248:Col6a4 UTSW 9 105,957,158 (GRCm39) missense probably benign 0.15
R2568:Col6a4 UTSW 9 105,940,275 (GRCm39) missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 105,897,864 (GRCm39) critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 105,949,313 (GRCm39) missense probably damaging 0.98
R3776:Col6a4 UTSW 9 105,928,900 (GRCm39) nonsense probably null
R3872:Col6a4 UTSW 9 105,890,858 (GRCm39) missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 105,949,610 (GRCm39) nonsense probably null
R4056:Col6a4 UTSW 9 105,903,665 (GRCm39) missense probably damaging 0.98
R4212:Col6a4 UTSW 9 105,952,569 (GRCm39) missense probably benign 0.28
R4417:Col6a4 UTSW 9 105,949,215 (GRCm39) missense probably damaging 0.99
R4683:Col6a4 UTSW 9 105,957,329 (GRCm39) missense probably benign 0.00
R4719:Col6a4 UTSW 9 105,945,451 (GRCm39) missense probably damaging 0.99
R4791:Col6a4 UTSW 9 105,957,401 (GRCm39) missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 105,949,178 (GRCm39) missense probably benign 0.00
R4886:Col6a4 UTSW 9 105,937,271 (GRCm39) missense probably benign 0.00
R4998:Col6a4 UTSW 9 105,867,977 (GRCm39) utr 3 prime probably benign
R5091:Col6a4 UTSW 9 105,952,262 (GRCm39) missense probably damaging 1.00
R5113:Col6a4 UTSW 9 105,944,159 (GRCm39) missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 105,890,576 (GRCm39) missense probably damaging 0.98
R5231:Col6a4 UTSW 9 105,902,730 (GRCm39) missense probably damaging 0.96
R5297:Col6a4 UTSW 9 105,952,066 (GRCm39) missense probably benign 0.02
R5352:Col6a4 UTSW 9 105,938,743 (GRCm39) missense probably damaging 1.00
R5438:Col6a4 UTSW 9 105,890,895 (GRCm39) missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 105,949,387 (GRCm39) missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 105,949,397 (GRCm39) missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105,873,315 (GRCm39) missense probably benign 0.01
R5662:Col6a4 UTSW 9 105,945,200 (GRCm39) missense probably damaging 0.99
R5777:Col6a4 UTSW 9 105,890,895 (GRCm39) missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 105,957,474 (GRCm39) missense probably damaging 0.99
R5929:Col6a4 UTSW 9 105,940,243 (GRCm39) missense probably benign 0.15
R5999:Col6a4 UTSW 9 105,945,120 (GRCm39) missense probably benign 0.11
R6243:Col6a4 UTSW 9 105,890,589 (GRCm39) missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 105,952,185 (GRCm39) missense probably damaging 0.96
R6288:Col6a4 UTSW 9 105,945,462 (GRCm39) missense probably damaging 0.99
R6361:Col6a4 UTSW 9 105,943,902 (GRCm39) missense probably benign 0.28
R6485:Col6a4 UTSW 9 105,954,069 (GRCm39) critical splice donor site probably null
R6490:Col6a4 UTSW 9 105,952,191 (GRCm39) nonsense probably null
R6537:Col6a4 UTSW 9 105,945,153 (GRCm39) missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 105,877,611 (GRCm39) missense probably damaging 0.99
R6643:Col6a4 UTSW 9 105,877,830 (GRCm39) missense probably damaging 0.96
R6905:Col6a4 UTSW 9 105,937,517 (GRCm39) splice site probably null
R6944:Col6a4 UTSW 9 105,949,370 (GRCm39) missense probably damaging 0.98
R7015:Col6a4 UTSW 9 105,910,954 (GRCm39) critical splice donor site probably null
R7027:Col6a4 UTSW 9 105,944,213 (GRCm39) missense probably damaging 1.00
R7088:Col6a4 UTSW 9 105,877,885 (GRCm39) missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 105,949,448 (GRCm39) missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 105,877,519 (GRCm39) missense probably damaging 0.99
R7273:Col6a4 UTSW 9 105,877,656 (GRCm39) missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 105,954,091 (GRCm39) missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 105,900,114 (GRCm39) missense probably damaging 1.00
R7421:Col6a4 UTSW 9 105,897,994 (GRCm39) missense probably damaging 0.99
R7530:Col6a4 UTSW 9 105,945,589 (GRCm39) missense probably damaging 0.99
R7600:Col6a4 UTSW 9 105,944,198 (GRCm39) missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 105,960,087 (GRCm39) missense probably benign 0.17
R7830:Col6a4 UTSW 9 105,952,589 (GRCm39) missense probably damaging 0.99
R7881:Col6a4 UTSW 9 105,957,497 (GRCm39) missense probably benign 0.14
R8157:Col6a4 UTSW 9 105,945,097 (GRCm39) missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 105,954,076 (GRCm39) missense probably benign 0.01
R8309:Col6a4 UTSW 9 105,952,414 (GRCm39) missense probably benign 0.08
R8336:Col6a4 UTSW 9 105,952,528 (GRCm39) missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 105,945,583 (GRCm39) missense probably benign 0.00
R8530:Col6a4 UTSW 9 105,957,704 (GRCm39) missense probably benign 0.31
R8556:Col6a4 UTSW 9 105,944,252 (GRCm39) missense probably damaging 0.96
R8832:Col6a4 UTSW 9 105,949,353 (GRCm39) missense probably benign
R9001:Col6a4 UTSW 9 105,944,370 (GRCm39) missense probably benign 0.26
R9009:Col6a4 UTSW 9 105,954,404 (GRCm39) missense probably benign 0.38
R9069:Col6a4 UTSW 9 105,952,138 (GRCm39) missense possibly damaging 0.85
R9155:Col6a4 UTSW 9 105,952,209 (GRCm39) missense probably benign
R9175:Col6a4 UTSW 9 105,957,560 (GRCm39) missense probably benign
R9176:Col6a4 UTSW 9 105,938,755 (GRCm39) missense probably damaging 1.00
R9295:Col6a4 UTSW 9 105,957,734 (GRCm39) missense probably damaging 1.00
R9298:Col6a4 UTSW 9 105,945,534 (GRCm39) missense probably damaging 0.96
R9389:Col6a4 UTSW 9 105,877,983 (GRCm39) missense probably damaging 1.00
R9424:Col6a4 UTSW 9 105,945,271 (GRCm39) missense probably benign 0.30
R9576:Col6a4 UTSW 9 105,945,271 (GRCm39) missense probably benign 0.30
RF022:Col6a4 UTSW 9 105,954,207 (GRCm39) missense probably damaging 0.99
X0025:Col6a4 UTSW 9 105,877,654 (GRCm39) missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 105,878,069 (GRCm39) missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 105,877,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAACTGATAAGTGGCAGATGTACG -3'
(R):5'- CCTCAGATAGTTGTCCTGGTGAC -3'

Sequencing Primer
(F):5'- ATCCTTCAAGGCCAGCTCG -3'
(R):5'- TGGTGACAGATGGGGAGTCC -3'
Posted On 2014-10-01