Incidental Mutation 'R2149:Col6a4'
ID234121
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 040152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2149 (G1)
Quality Score213
Status Not validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106076929 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 404 (A404S)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably benign
Transcript: ENSMUST00000121963
AA Change: A404S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: A404S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137847
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAACTGATAAGTGGCAGATGTACG -3'
(R):5'- CCTCAGATAGTTGTCCTGGTGAC -3'

Sequencing Primer
(F):5'- ATCCTTCAAGGCCAGCTCG -3'
(R):5'- TGGTGACAGATGGGGAGTCC -3'
Posted On2014-10-01