Mutagenetix > Incidental Mutation

Incidental Mutation 'R2149:Stab2'

234124

Institutional Source

Beutler Lab

Gene Symbol

Stab2

Ensembl Gene

ENSMUSG00000035459

Gene Name

stabilin 2

Synonyms

STAB-2, FEEL-2

MMRRC Submission

040152-MU

Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2149 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86841198-87008025 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 86865040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 457 (C457*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035288]

AlphaFold

Q8R4U0

Predicted Effect

probably null
Transcript: ENSMUST00000035288
AA Change: C1909*

SMART Domains

Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: C1909*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
EGF	119	156	1.85e0	SMART
EGF	167	201	2.43e1	SMART
EGF	206	244	1.43e-1	SMART
EGF	248	284	3.82e-2	SMART
EGF	333	370	2.02e-1	SMART
FAS1	414	515	1.06e-8	SMART
FAS1	561	662	3.54e-19	SMART
EGF	746	783	6.76e-3	SMART
EGF	836	873	1.31e0	SMART
EGF	877	917	2.99e-4	SMART
EGF	921	960	3.51e-1	SMART
EGF	964	1002	1.99e0	SMART
FAS1	1038	1138	1.73e-13	SMART
FAS1	1181	1276	1.83e-12	SMART
EGF	1354	1391	6.92e0	SMART
EGF	1401	1435	1.11e1	SMART
EGF	1442	1477	3.01e0	SMART
EGF	1481	1519	1.64e-1	SMART
EGF	1523	1561	1.14e0	SMART
EGF	1565	1603	5.62e0	SMART
FAS1	1638	1734	2.23e-25	SMART
FAS1	1785	1891	6.92e-22	SMART
EGF	1966	2006	1.95e1	SMART
EGF_like	1977	2017	2.46e-1	SMART
EGF	2016	2050	1.14e0	SMART
EGF	2058	2089	1.56e1	SMART
EGF	2093	2130	1.36e1	SMART
EGF	2134	2173	2.13e0	SMART
LINK	2204	2298	2.08e-29	SMART
FAS1	2363	2455	3.19e-12	SMART
transmembrane domain	2467	2489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159445

Predicted Effect

probably null
Transcript: ENSMUST00000161560
AA Change: C458*

SMART Domains

Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459
AA Change: C458*

Domain	Start	End	E-Value	Type
EGF	30	68	1.64e-1	SMART
EGF	72	110	1.14e0	SMART
EGF	114	152	5.62e0	SMART
FAS1	187	283	2.23e-25	SMART
FAS1	334	440	6.92e-22	SMART
EGF	515	555	1.95e1	SMART
EGF_like	526	566	2.46e-1	SMART
EGF	565	599	1.14e0	SMART
EGF	607	638	1.56e1	SMART
EGF	643	680	1.36e1	SMART
EGF	684	723	2.13e0	SMART
LINK	754	848	2.08e-29	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000219341
AA Change: C457*

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	A	G	1: 43,742,336	D126G	probably damaging	Het
1700006A11Rik	T	C	3: 124,409,686	E414G	probably benign	Het
3632451O06Rik	T	C	14: 49,751,571	D647G	probably benign	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Abca13	A	G	11: 9,267,508	T317A	possibly damaging	Het
Acap3	T	G	4: 155,905,625	L750R	probably damaging	Het
Anapc7	T	A	5: 122,443,826	S511T	probably benign	Het
Anp32a	T	A	9: 62,371,802	F46Y	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arid2	T	C	15: 96,370,835	I943T	probably damaging	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
BC003331	A	T	1: 150,388,559	N66K	probably benign	Het
Btnl6	T	C	17: 34,514,347	N218S	possibly damaging	Het
Capn11	T	C	17: 45,633,107		probably null	Het
Clcnkb	C	T	4: 141,408,017	G470D	probably damaging	Het
Clic6	T	A	16: 92,499,207	S252T	probably benign	Het
Col28a1	T	C	6: 8,155,383	K318E	possibly damaging	Het
Col5a3	A	T	9: 20,771,270	V1626D	unknown	Het
Col6a4	C	A	9: 106,076,929	A404S	probably benign	Het
Cyp2j5	G	T	4: 96,641,340	H265N	possibly damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dock2	A	G	11: 34,229,472		probably null	Het
Emilin2	T	C	17: 71,273,992	S580G	probably benign	Het
Fbn2	C	A	18: 58,102,325		probably null	Het
Gfm1	T	C	3: 67,474,560	L693P	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gpha2	A	G	19: 6,226,982	T38A	probably damaging	Het
Gtf2h3	T	C	5: 124,599,785		probably benign	Het
Hmgxb3	T	C	18: 61,157,674	T376A	probably benign	Het
Hspa12b	A	G	2: 131,143,057	D416G	probably damaging	Het
Immt	C	T	6: 71,844,675	R28*	probably null	Het
Iqgap1	T	C	7: 80,762,560	Y180C	probably damaging	Het
Kcnq3	T	A	15: 66,023,729	D322V	probably damaging	Het
Kifc2	C	A	15: 76,662,221	L268I	probably benign	Het
Lama1	T	C	17: 67,773,865	M1296T	possibly damaging	Het
Lipk	A	G	19: 34,021,617	N104S	possibly damaging	Het
Lrrc14b	T	A	13: 74,363,757	N68I	possibly damaging	Het
Lrrc28	A	T	7: 67,531,682	D268E	probably damaging	Het
Ly6c2	T	C	15: 75,108,543	*132W	probably null	Het
Msh6	A	G	17: 87,986,088	E757G	probably damaging	Het
Mtss1l	T	C	8: 110,726,383	V47A	possibly damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Nalcn	A	T	14: 123,370,017	I680N	probably benign	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1501	A	C	19: 13,838,582	V197G	probably damaging	Het
Olfr61	C	T	7: 140,638,052	T117M	probably damaging	Het
Olfr713	A	T	7: 107,036,338	Y61F	possibly damaging	Het
Olfr912	T	C	9: 38,581,508	V77A	probably benign	Het
Oosp2	A	T	19: 11,649,614	L17*	probably null	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pde4dip	T	A	3: 97,792,836	Q300L	possibly damaging	Het
Phf2	T	C	13: 48,804,689	K950E	unknown	Het
Pira2	G	A	7: 3,844,171	P124L	probably damaging	Het
Plpp4	C	T	7: 129,379,371	T157I	probably benign	Het
Polrmt	G	A	10: 79,740,275	Q545*	probably null	Het
Ptprs	A	G	17: 56,417,706	F1511L	probably damaging	Het
Sbno1	T	C	5: 124,402,119		probably null	Het
Setd1a	T	A	7: 127,786,518	V256D	possibly damaging	Het
Slamf1	T	C	1: 171,767,272	S16P	probably damaging	Het
Slc16a14	T	C	1: 84,907,399	D473G	probably damaging	Het
Slc8a2	A	T	7: 16,159,164	H917L	probably damaging	Het
Sorbs2	A	C	8: 45,795,443	D442A	probably damaging	Het
Srp68	G	T	11: 116,260,867	T301K	possibly damaging	Het
Stk31	T	G	6: 49,439,218	S652R	possibly damaging	Het
Stra6	T	G	9: 58,152,539	S594R	probably benign	Het
Tbc1d9	G	A	8: 83,271,449	E1212K	probably damaging	Het
Thada	C	T	17: 84,441,764	R593Q	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tmem132c	T	A	5: 127,462,962	W351R	probably damaging	Het
Tmem206	T	G	1: 191,345,109	F210V	probably benign	Het
Trim10	C	T	17: 36,877,014	A374V	probably benign	Het
Try10	T	C	6: 41,356,561	V80A	probably benign	Het
Ttn	T	C	2: 76,729,363	T29565A	possibly damaging	Het
Uggt2	G	T	14: 119,075,345	Q351K	probably benign	Het
Vmn1r120	A	T	7: 21,052,964	V274D	probably damaging	Het
Vmn1r62	A	T	7: 5,675,359	H13L	probably benign	Het
Vmn2r101	C	T	17: 19,588,963	T118I	probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Wnt5a	A	G	14: 28,513,317	Y86C	probably damaging	Het
Xpa	T	C	4: 46,183,189	E200G	probably damaging	Het
Zc3h12a	C	T	4: 125,126,642	R136K	possibly damaging	Het
Zc3hav1	T	C	6: 38,336,537	H191R	probably damaging	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Stab2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Stab2	APN	10	86869206	splice site	probably null
IGL00809:Stab2	APN	10	86848174	splice site	probably benign
IGL00911:Stab2	APN	10	86969753	missense	probably damaging	1.00
IGL01347:Stab2	APN	10	86901703	splice site	probably null
IGL01411:Stab2	APN	10	86980008	splice site	probably benign
IGL01503:Stab2	APN	10	86940613	splice site	probably benign
IGL01599:Stab2	APN	10	86922895	missense	probably damaging	1.00
IGL01635:Stab2	APN	10	86981128	missense	probably benign	0.04
IGL01640:Stab2	APN	10	86954171	missense	probably benign	0.09
IGL01671:Stab2	APN	10	86969277	missense	possibly damaging	0.80
IGL02023:Stab2	APN	10	86871831	missense	possibly damaging	0.67
IGL02075:Stab2	APN	10	86967650	missense	possibly damaging	0.71
IGL02174:Stab2	APN	10	86859742	splice site	probably null
IGL02600:Stab2	APN	10	86954259	missense	probably damaging	1.00
IGL02666:Stab2	APN	10	86850902	missense	possibly damaging	0.67
IGL02668:Stab2	APN	10	86846163	splice site	probably benign
IGL02709:Stab2	APN	10	86846165	splice site	probably benign
IGL02728:Stab2	APN	10	86856556	missense	possibly damaging	0.95
IGL02803:Stab2	APN	10	86950269	splice site	probably benign
IGL02938:Stab2	APN	10	86871921	missense	possibly damaging	0.77
IGL03033:Stab2	APN	10	86996803	critical splice donor site	probably null
IGL03238:Stab2	APN	10	86855121	missense	probably damaging	1.00
IGL03402:Stab2	APN	10	86969301	missense	probably benign	0.03
prospector	UTSW	10	86901567	splice site	probably null
songbird	UTSW	10	86858152	missense	probably damaging	1.00
3-1:Stab2	UTSW	10	86869177	missense	probably damaging	0.96
F6893:Stab2	UTSW	10	86855171	missense	probably damaging	1.00
K7371:Stab2	UTSW	10	86943289	critical splice donor site	probably null
PIT4142001:Stab2	UTSW	10	86867175	missense	possibly damaging	0.94
PIT4362001:Stab2	UTSW	10	86861435	nonsense	probably null
R0015:Stab2	UTSW	10	86843617	missense	probably benign
R0254:Stab2	UTSW	10	86897960	missense	probably benign
R0310:Stab2	UTSW	10	86967613	splice site	probably benign
R0333:Stab2	UTSW	10	86841627	missense	probably benign
R0391:Stab2	UTSW	10	86947144	missense	probably benign	0.27
R0400:Stab2	UTSW	10	86872610	missense	probably damaging	1.00
R0433:Stab2	UTSW	10	86843491	splice site	probably benign
R0440:Stab2	UTSW	10	86949928	missense	probably benign	0.23
R0743:Stab2	UTSW	10	86887895	missense	probably damaging	1.00
R0847:Stab2	UTSW	10	86969871	missense	probably benign	0.00
R0883:Stab2	UTSW	10	86924450	splice site	probably benign
R1078:Stab2	UTSW	10	86907133	splice site	probably null
R1118:Stab2	UTSW	10	86885718	splice site	probably null
R1119:Stab2	UTSW	10	86859755	missense	possibly damaging	0.51
R1179:Stab2	UTSW	10	86950301	missense	probably damaging	0.98
R1440:Stab2	UTSW	10	86861367	splice site	probably null
R1550:Stab2	UTSW	10	86878926	missense	probably benign	0.01
R1616:Stab2	UTSW	10	86885718	splice site	probably null
R1728:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1768:Stab2	UTSW	10	87003008	missense	probably damaging	1.00
R1772:Stab2	UTSW	10	86954234	missense	probably benign	0.06
R1776:Stab2	UTSW	10	86957816	missense	possibly damaging	0.92
R1784:Stab2	UTSW	10	86938039	missense	probably benign	0.41
R1892:Stab2	UTSW	10	86938049	missense	probably damaging	0.99
R1957:Stab2	UTSW	10	86861470	missense	probably benign	0.13
R1972:Stab2	UTSW	10	86960316	missense	probably damaging	0.99
R1975:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1976:Stab2	UTSW	10	86896496	critical splice donor site	probably null
R1996:Stab2	UTSW	10	87003031	missense	probably damaging	1.00
R2085:Stab2	UTSW	10	86954159	missense	probably damaging	1.00
R2169:Stab2	UTSW	10	86887862	missense	probably damaging	1.00
R2201:Stab2	UTSW	10	86940639	missense	probably benign	0.22
R2296:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2297:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2298:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2326:Stab2	UTSW	10	86954474	critical splice acceptor site	probably null
R2434:Stab2	UTSW	10	86969319	missense	possibly damaging	0.78
R2519:Stab2	UTSW	10	86934840	splice site	probably benign
R2696:Stab2	UTSW	10	86861499	missense	probably benign	0.45
R2883:Stab2	UTSW	10	86967686	missense	possibly damaging	0.92
R2923:Stab2	UTSW	10	86861461	missense	probably damaging	1.00
R3711:Stab2	UTSW	10	86866708	missense	probably damaging	1.00
R3787:Stab2	UTSW	10	86969277	missense	possibly damaging	0.50
R3834:Stab2	UTSW	10	86949912	missense	possibly damaging	0.87
R3970:Stab2	UTSW	10	86878886	missense	probably damaging	0.97
R3979:Stab2	UTSW	10	86863456	missense	possibly damaging	0.56
R4003:Stab2	UTSW	10	86858124	missense	probably damaging	1.00
R4088:Stab2	UTSW	10	86922185	missense	probably damaging	1.00
R4151:Stab2	UTSW	10	87002983	missense	probably benign	0.12
R4190:Stab2	UTSW	10	86878944	missense	probably damaging	0.98
R4556:Stab2	UTSW	10	86967679	missense	possibly damaging	0.95
R4773:Stab2	UTSW	10	86907371	nonsense	probably null
R4825:Stab2	UTSW	10	86947147	missense	probably benign	0.08
R4865:Stab2	UTSW	10	86843500	splice site	probably null
R4871:Stab2	UTSW	10	86942235	missense	probably damaging	0.99
R4943:Stab2	UTSW	10	86954162	missense	probably damaging	0.99
R4981:Stab2	UTSW	10	86960223	missense	probably benign
R4994:Stab2	UTSW	10	86949907	missense	probably benign
R4999:Stab2	UTSW	10	86937909	missense	probably damaging	0.97
R5061:Stab2	UTSW	10	86907385	missense	probably damaging	1.00
R5072:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5073:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5074:Stab2	UTSW	10	86863558	missense	probably benign	0.23
R5134:Stab2	UTSW	10	86871810	splice site	probably null
R5213:Stab2	UTSW	10	86907197	missense	probably damaging	0.99
R5508:Stab2	UTSW	10	86960279	missense	probably benign	0.01
R5530:Stab2	UTSW	10	86947162	missense	probably benign	0.04
R5540:Stab2	UTSW	10	86848125	missense	probably benign	0.30
R5839:Stab2	UTSW	10	86872691	missense	probably damaging	0.97
R5949:Stab2	UTSW	10	86969849	missense	possibly damaging	0.87
R6015:Stab2	UTSW	10	86938042	missense	probably damaging	0.99
R6019:Stab2	UTSW	10	87003022	missense	probably benign	0.00
R6116:Stab2	UTSW	10	86907190	missense	probably damaging	1.00
R6131:Stab2	UTSW	10	86883778	splice site	probably null
R6209:Stab2	UTSW	10	86923003	missense	possibly damaging	0.94
R6243:Stab2	UTSW	10	86907161	missense	probably damaging	1.00
R6433:Stab2	UTSW	10	86901567	splice site	probably null
R6787:Stab2	UTSW	10	86919084	missense	probably benign	0.07
R6841:Stab2	UTSW	10	86942190	missense	probably damaging	1.00
R6873:Stab2	UTSW	10	86861366	critical splice donor site	probably null
R7025:Stab2	UTSW	10	86850837	missense	probably damaging	1.00
R7043:Stab2	UTSW	10	86870246	missense	probably damaging	0.99
R7047:Stab2	UTSW	10	86858152	missense	probably damaging	1.00
R7107:Stab2	UTSW	10	86905592	missense	possibly damaging	0.96
R7214:Stab2	UTSW	10	86899841	missense	probably damaging	0.99
R7271:Stab2	UTSW	10	87003108	splice site	probably null
R7291:Stab2	UTSW	10	86946220	missense	probably damaging	0.96
R7336:Stab2	UTSW	10	86969185	nonsense	probably null
R7432:Stab2	UTSW	10	86885683	missense	probably damaging	0.99
R7580:Stab2	UTSW	10	86869164	missense	probably benign	0.00
R7622:Stab2	UTSW	10	86873902	missense	possibly damaging	0.65
R7629:Stab2	UTSW	10	86883782	critical splice donor site	probably null
R7658:Stab2	UTSW	10	86981135	missense	probably benign	0.12
R7798:Stab2	UTSW	10	86957912	missense	probably damaging	0.98
R7835:Stab2	UTSW	10	86872619	missense	probably benign	0.06
R7845:Stab2	UTSW	10	86996894	missense	probably benign	0.09
R7863:Stab2	UTSW	10	86972881	missense	probably benign	0.30
R7885:Stab2	UTSW	10	86878912	missense	probably benign	0.03
R7904:Stab2	UTSW	10	86954192	nonsense	probably null
R7947:Stab2	UTSW	10	86846033	missense	probably benign	0.31
R7963:Stab2	UTSW	10	86848023	critical splice donor site	probably null
R8014:Stab2	UTSW	10	86850903	missense	possibly damaging	0.78
R8021:Stab2	UTSW	10	86905539	missense	possibly damaging	0.69
R8024:Stab2	UTSW	10	86846052	missense	probably benign	0.34
R8097:Stab2	UTSW	10	86869095	missense	possibly damaging	0.86
R8281:Stab2	UTSW	10	86873864	missense	probably damaging	0.98
R8462:Stab2	UTSW	10	86967734	missense	possibly damaging	0.79
R8670:Stab2	UTSW	10	86940723	missense	probably damaging	1.00
R8692:Stab2	UTSW	10	86972930	missense	probably damaging	0.99
R8744:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8745:Stab2	UTSW	10	86969349	missense	probably benign	0.32
R8782:Stab2	UTSW	10	86899821	missense	probably benign	0.00
R8875:Stab2	UTSW	10	86996864	missense	probably damaging	1.00
R8978:Stab2	UTSW	10	86949918	missense	possibly damaging	0.64
R9141:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9248:Stab2	UTSW	10	86891617	missense	probably damaging	0.98
R9326:Stab2	UTSW	10	86955146	missense	probably damaging	1.00
R9426:Stab2	UTSW	10	86869047	missense	probably damaging	1.00
R9568:Stab2	UTSW	10	86863556	missense	probably damaging	1.00
R9627:Stab2	UTSW	10	86957840	missense	probably damaging	0.98
R9635:Stab2	UTSW	10	86850787	nonsense	probably null
R9648:Stab2	UTSW	10	86856697	frame shift	probably null
R9649:Stab2	UTSW	10	86856697	frame shift	probably null
R9650:Stab2	UTSW	10	86856697	frame shift	probably null
R9726:Stab2	UTSW	10	86954231	missense	probably benign	0.00
R9756:Stab2	UTSW	10	86967689	missense	possibly damaging	0.50
R9786:Stab2	UTSW	10	86922133	missense	probably benign	0.03
RF061:Stab2	UTSW	10	86866758	critical splice acceptor site	probably benign
X0023:Stab2	UTSW	10	86922198	critical splice acceptor site	probably null
X0025:Stab2	UTSW	10	86887816	missense	probably damaging	1.00
Z1176:Stab2	UTSW	10	86949914	missense	probably damaging	0.99
Z1177:Stab2	UTSW	10	86896596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCTACTAGAAGACTGAGGTC -3'
(R):5'- CTCGCGCATCTCTTTGTGAAG -3'

Sequencing Primer
(F):5'- GTCTGATAATGAAGCACACCCGTTG -3'
(R):5'- GAATCTAGGATTCACTGGTCCAGC -3'

Posted On

2014-10-01