Incidental Mutation 'R2149:Stab2'
ID234124
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 040152-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2149 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86865040 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 457 (C457*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect probably null
Transcript: ENSMUST00000035288
AA Change: C1909*
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: C1909*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159445
Predicted Effect probably null
Transcript: ENSMUST00000161560
AA Change: C458*
SMART Domains Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459
AA Change: C458*

DomainStartEndE-ValueType
EGF 30 68 1.64e-1 SMART
EGF 72 110 1.14e0 SMART
EGF 114 152 5.62e0 SMART
FAS1 187 283 2.23e-25 SMART
FAS1 334 440 6.92e-22 SMART
EGF 515 555 1.95e1 SMART
EGF_like 526 566 2.46e-1 SMART
EGF 565 599 1.14e0 SMART
EGF 607 638 1.56e1 SMART
EGF 643 680 1.36e1 SMART
EGF 684 723 2.13e0 SMART
LINK 754 848 2.08e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000219341
AA Change: C457*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
R7798:Stab2 UTSW 10 86957912 missense probably damaging 0.98
R7835:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7845:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7863:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7885:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7904:Stab2 UTSW 10 86954192 nonsense probably null
R7918:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7928:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7946:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7968:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7987:Stab2 UTSW 10 86954192 nonsense probably null
R8014:Stab2 UTSW 10 86850903 missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86905539 missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86846052 missense probably benign 0.34
RF061:Stab2 UTSW 10 86866758 critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86949914 missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86896596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTACTAGAAGACTGAGGTC -3'
(R):5'- CTCGCGCATCTCTTTGTGAAG -3'

Sequencing Primer
(F):5'- GTCTGATAATGAAGCACACCCGTTG -3'
(R):5'- GAATCTAGGATTCACTGGTCCAGC -3'
Posted On2014-10-01