Incidental Mutation 'R2149:Nalcn'
ID 234139
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123607429 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 680 (I680N)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000201
AA Change: I680N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: I680N

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0359:Nalcn UTSW 14 123,536,580 (GRCm39) missense probably damaging 1.00
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0400:Nalcn UTSW 14 123,528,372 (GRCm39) splice site probably benign
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1689:Nalcn UTSW 14 123,522,666 (GRCm39) missense probably damaging 1.00
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2016:Nalcn UTSW 14 123,831,993 (GRCm39) splice site probably null
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123,752,777 (GRCm39) missense probably damaging 1.00
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7018:Nalcn UTSW 14 123,647,233 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTACAGACTTAGGAATTGAG -3'
(R):5'- GTTTGCAAGGATTCAGGAAGC -3'

Sequencing Primer
(F):5'- CCTACAGACTTAGGAATTGAGGACTC -3'
(R):5'- GCAAGGATTCAGGAAGCTTTTTC -3'
Posted On 2014-10-01