Incidental Mutation 'R2149:Kifc2'
ID234143
Institutional Source Beutler Lab
Gene Symbol Kifc2
Ensembl Gene ENSMUSG00000004187
Gene Namekinesin family member C2
Synonyms
MMRRC Submission 040152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2149 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76659858-76668196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76662221 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 268 (L268I)
Ref Sequence ENSEMBL: ENSMUSP00000004294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000066677] [ENSMUST00000081291] [ENSMUST00000177359] [ENSMUST00000230451] [ENSMUST00000230964] [ENSMUST00000231152]
Predicted Effect probably benign
Transcript: ENSMUST00000004294
AA Change: L268I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187
AA Change: L268I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066677
SMART Domains Protein: ENSMUSP00000063317
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081291
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177359
SMART Domains Protein: ENSMUSP00000135505
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230124
Predicted Effect probably benign
Transcript: ENSMUST00000230451
AA Change: L183I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230719
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Predicted Effect probably benign
Transcript: ENSMUST00000231152
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no apparent defects in development or behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Kifc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kifc2 APN 15 76667462 utr 3 prime probably benign
IGL01341:Kifc2 APN 15 76662898 critical splice donor site probably null
IGL02161:Kifc2 APN 15 76666045 missense probably damaging 1.00
IGL02675:Kifc2 APN 15 76662979 missense probably damaging 1.00
IGL02997:Kifc2 APN 15 76664339 missense possibly damaging 0.83
R0034:Kifc2 UTSW 15 76667100 missense probably benign 0.18
R1818:Kifc2 UTSW 15 76666081 missense probably damaging 1.00
R1961:Kifc2 UTSW 15 76662825 missense probably damaging 1.00
R2104:Kifc2 UTSW 15 76661254 missense probably damaging 0.99
R3086:Kifc2 UTSW 15 76667252 missense probably benign 0.01
R4704:Kifc2 UTSW 15 76662977 unclassified probably null
R4782:Kifc2 UTSW 15 76664348 missense possibly damaging 0.89
R4834:Kifc2 UTSW 15 76661311 start codon destroyed probably null 0.48
R5085:Kifc2 UTSW 15 76661296 missense probably damaging 1.00
R5160:Kifc2 UTSW 15 76662977 missense probably damaging 1.00
R5253:Kifc2 UTSW 15 76666281 missense possibly damaging 0.94
R5543:Kifc2 UTSW 15 76667042 missense probably damaging 0.99
R5786:Kifc2 UTSW 15 76664378 missense probably damaging 1.00
R5805:Kifc2 UTSW 15 76662153 missense probably benign 0.00
R7290:Kifc2 UTSW 15 76660704 missense probably damaging 1.00
R7311:Kifc2 UTSW 15 76662810 missense probably damaging 1.00
R7511:Kifc2 UTSW 15 76661337 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTCAGGGGAATTTCAGGTG -3'
(R):5'- CAACTTCATGCAAGGCTCCC -3'

Sequencing Primer
(F):5'- AGGTGGGTCCTGATGATATCCCTC -3'
(R):5'- TTCCTGAGGTTTCACAGAGAGAC -3'
Posted On2014-10-01