Incidental Mutation 'R2149:Btnl6'
ID 234151
Institutional Source Beutler Lab
Gene Symbol Btnl6
Ensembl Gene ENSMUSG00000092618
Gene Name butyrophilin-like 6
Synonyms Gm6519, NG13
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34726778-34736326 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34733321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 218 (N218S)
Ref Sequence ENSEMBL: ENSMUSP00000074927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075483]
AlphaFold A2CG22
Predicted Effect possibly damaging
Transcript: ENSMUST00000075483
AA Change: N218S

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074927
Gene: ENSMUSG00000092618
AA Change: N218S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.06e-5 SMART
SCOP:d1c5ch2 151 222 1e-2 SMART
Blast:IG_like 152 228 2e-23 BLAST
transmembrane domain 252 271 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
SPRY 384 509 1.23e-19 SMART
low complexity region 510 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Btnl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Btnl6 APN 17 34,733,017 (GRCm39) missense probably benign 0.00
IGL02501:Btnl6 APN 17 34,734,648 (GRCm39) missense possibly damaging 0.82
IGL02539:Btnl6 APN 17 34,727,288 (GRCm39) missense probably benign 0.00
IGL02629:Btnl6 APN 17 34,733,442 (GRCm39) missense probably damaging 1.00
IGL02724:Btnl6 APN 17 34,727,149 (GRCm39) nonsense probably null
IGL03366:Btnl6 APN 17 34,727,153 (GRCm39) missense probably damaging 1.00
R0013:Btnl6 UTSW 17 34,734,505 (GRCm39) nonsense probably null
R0025:Btnl6 UTSW 17 34,733,273 (GRCm39) missense probably benign 0.02
R0144:Btnl6 UTSW 17 34,732,994 (GRCm39) missense probably benign 0.29
R0255:Btnl6 UTSW 17 34,727,477 (GRCm39) missense probably benign 0.01
R1474:Btnl6 UTSW 17 34,732,620 (GRCm39) missense probably damaging 1.00
R1757:Btnl6 UTSW 17 34,733,062 (GRCm39) missense probably benign 0.09
R1838:Btnl6 UTSW 17 34,734,516 (GRCm39) missense probably damaging 0.99
R2994:Btnl6 UTSW 17 34,734,498 (GRCm39) missense possibly damaging 0.82
R3441:Btnl6 UTSW 17 34,727,292 (GRCm39) missense probably benign 0.06
R3809:Btnl6 UTSW 17 34,727,202 (GRCm39) missense probably benign 0.00
R3936:Btnl6 UTSW 17 34,736,316 (GRCm39) missense probably benign
R4462:Btnl6 UTSW 17 34,727,031 (GRCm39) missense probably damaging 1.00
R4604:Btnl6 UTSW 17 34,727,435 (GRCm39) missense possibly damaging 0.91
R4618:Btnl6 UTSW 17 34,733,120 (GRCm39) missense probably damaging 0.98
R4832:Btnl6 UTSW 17 34,732,966 (GRCm39) missense possibly damaging 0.80
R5369:Btnl6 UTSW 17 34,726,959 (GRCm39) nonsense probably null
R5422:Btnl6 UTSW 17 34,733,081 (GRCm39) missense possibly damaging 0.93
R6046:Btnl6 UTSW 17 34,727,371 (GRCm39) missense probably damaging 1.00
R6170:Btnl6 UTSW 17 34,734,480 (GRCm39) missense probably damaging 0.99
R6385:Btnl6 UTSW 17 34,727,343 (GRCm39) missense probably benign 0.01
R8213:Btnl6 UTSW 17 34,727,857 (GRCm39) splice site probably null
R8676:Btnl6 UTSW 17 34,727,043 (GRCm39) missense probably benign 0.00
R8895:Btnl6 UTSW 17 34,734,391 (GRCm39) missense probably benign 0.01
R9654:Btnl6 UTSW 17 34,733,140 (GRCm39) missense probably damaging 1.00
R9665:Btnl6 UTSW 17 34,732,635 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAAAGAAGGGCTCTGTC -3'
(R):5'- CTCTGTCCCTGAAGTGTACATC -3'

Sequencing Primer
(F):5'- TCGCCCAGGCAGAGAGAC -3'
(R):5'- GTCCCTGAAGTGTACATCAAAGGTC -3'
Posted On 2014-10-01