Incidental Mutation 'R2149:Trim10'
ID 234152
Institutional Source Beutler Lab
Gene Symbol Trim10
Ensembl Gene ENSMUSG00000073400
Gene Name tripartite motif-containing 10
Synonyms Rnf9, Herf1
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37180466-37188725 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37187906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 374 (A374V)
Ref Sequence ENSEMBL: ENSMUSP00000057928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060524] [ENSMUST00000087158] [ENSMUST00000172711]
AlphaFold Q9WUH5
Predicted Effect probably benign
Transcript: ENSMUST00000060524
AA Change: A374V

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400
AA Change: A374V

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087158
SMART Domains Protein: ENSMUSP00000084400
Gene: ENSMUSG00000073399

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 1.1e-6 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172711
SMART Domains Protein: ENSMUSP00000133581
Gene: ENSMUSG00000073399

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 3.4e-7 PFAM
coiled coil region 106 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lama1 T C 17: 68,080,860 (GRCm39) M1296T possibly damaging Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Trim10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Trim10 APN 17 37,188,140 (GRCm39) missense probably benign 0.03
IGL00501:Trim10 APN 17 37,187,939 (GRCm39) missense probably benign 0.08
IGL00846:Trim10 APN 17 37,182,584 (GRCm39) missense probably damaging 1.00
IGL01536:Trim10 APN 17 37,188,180 (GRCm39) splice site probably null
IGL02814:Trim10 APN 17 37,188,228 (GRCm39) nonsense probably null
IGL03135:Trim10 APN 17 37,185,113 (GRCm39) missense possibly damaging 0.78
IGL03144:Trim10 APN 17 37,187,740 (GRCm39) missense probably damaging 1.00
IGL03298:Trim10 APN 17 37,187,917 (GRCm39) missense possibly damaging 0.87
PIT4378001:Trim10 UTSW 17 37,188,020 (GRCm39) missense probably damaging 0.98
R0102:Trim10 UTSW 17 37,181,074 (GRCm39) missense probably damaging 1.00
R0102:Trim10 UTSW 17 37,181,074 (GRCm39) missense probably damaging 1.00
R0834:Trim10 UTSW 17 37,183,283 (GRCm39) missense probably benign 0.00
R1517:Trim10 UTSW 17 37,183,346 (GRCm39) missense probably damaging 1.00
R1691:Trim10 UTSW 17 37,187,791 (GRCm39) missense probably damaging 1.00
R1696:Trim10 UTSW 17 37,188,073 (GRCm39) nonsense probably null
R3153:Trim10 UTSW 17 37,182,580 (GRCm39) missense probably damaging 1.00
R3154:Trim10 UTSW 17 37,182,580 (GRCm39) missense probably damaging 1.00
R5156:Trim10 UTSW 17 37,187,948 (GRCm39) missense probably damaging 0.99
R5327:Trim10 UTSW 17 37,181,081 (GRCm39) missense probably damaging 1.00
R5361:Trim10 UTSW 17 37,186,328 (GRCm39) missense probably benign 0.03
R5758:Trim10 UTSW 17 37,188,044 (GRCm39) missense possibly damaging 0.80
R5764:Trim10 UTSW 17 37,181,073 (GRCm39) missense probably damaging 0.97
R6032:Trim10 UTSW 17 37,182,606 (GRCm39) missense possibly damaging 0.87
R6032:Trim10 UTSW 17 37,182,606 (GRCm39) missense possibly damaging 0.87
R6179:Trim10 UTSW 17 37,187,923 (GRCm39) missense probably damaging 1.00
R6709:Trim10 UTSW 17 37,183,262 (GRCm39) missense probably damaging 0.99
R7172:Trim10 UTSW 17 37,180,955 (GRCm39) missense possibly damaging 0.78
R7197:Trim10 UTSW 17 37,187,846 (GRCm39) missense probably damaging 1.00
R7390:Trim10 UTSW 17 37,180,773 (GRCm39) start codon destroyed probably null 0.98
R7391:Trim10 UTSW 17 37,180,773 (GRCm39) start codon destroyed probably null 0.98
R7696:Trim10 UTSW 17 37,182,644 (GRCm39) missense probably damaging 1.00
R8830:Trim10 UTSW 17 37,180,846 (GRCm39) missense probably damaging 1.00
R8867:Trim10 UTSW 17 37,181,048 (GRCm39) missense probably benign 0.00
R8970:Trim10 UTSW 17 37,184,168 (GRCm39) missense probably benign 0.00
R9376:Trim10 UTSW 17 37,184,168 (GRCm39) missense probably benign 0.00
R9635:Trim10 UTSW 17 37,187,890 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGTAGCATTGACCTATTGAC -3'
(R):5'- AGAGATACCTGCACCTTCCG -3'

Sequencing Primer
(F):5'- AGCTCATATCTCTCTAGACCCCCAG -3'
(R):5'- TGCACCTTCCGGGGTTG -3'
Posted On 2014-10-01