Incidental Mutation 'R2149:Lama1'
ID 234155
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
MMRRC Submission 040152-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2149 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 68004254-68129642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68080860 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1296 (M1296T)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035471
AA Change: M1296T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: M1296T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,335 (GRCm39) E414G probably benign Het
Abca12 C A 1: 71,302,647 (GRCm39) V2191L probably benign Het
Abca13 A G 11: 9,217,508 (GRCm39) T317A possibly damaging Het
Acap3 T G 4: 155,990,082 (GRCm39) L750R probably damaging Het
Anapc7 T A 5: 122,581,889 (GRCm39) S511T probably benign Het
Anp32a T A 9: 62,279,084 (GRCm39) F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Arfgef1 C T 1: 10,270,103 (GRCm39) A349T probably benign Het
Arid2 T C 15: 96,268,716 (GRCm39) I943T probably damaging Het
Armh4 T C 14: 49,989,028 (GRCm39) D647G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Btnl6 T C 17: 34,733,321 (GRCm39) N218S possibly damaging Het
Capn11 T C 17: 45,944,033 (GRCm39) probably null Het
Clcnkb C T 4: 141,135,328 (GRCm39) G470D probably damaging Het
Clic6 T A 16: 92,296,095 (GRCm39) S252T probably benign Het
Col28a1 T C 6: 8,155,383 (GRCm39) K318E possibly damaging Het
Col5a3 A T 9: 20,682,566 (GRCm39) V1626D unknown Het
Col6a4 C A 9: 105,954,128 (GRCm39) A404S probably benign Het
Cyp2j5 G T 4: 96,529,577 (GRCm39) H265N possibly damaging Het
Dennd3 A T 15: 73,426,909 (GRCm39) H762L probably benign Het
Dock2 A G 11: 34,179,472 (GRCm39) probably null Het
Ecrg4 A G 1: 43,781,496 (GRCm39) D126G probably damaging Het
Emilin2 T C 17: 71,580,987 (GRCm39) S580G probably benign Het
Fbn2 C A 18: 58,235,397 (GRCm39) probably null Het
Gfm1 T C 3: 67,381,893 (GRCm39) L693P probably damaging Het
Glb1 T C 9: 114,279,716 (GRCm39) Y375H probably damaging Het
Gpha2 A G 19: 6,277,012 (GRCm39) T38A probably damaging Het
Gtf2h3 T C 5: 124,737,848 (GRCm39) probably benign Het
Hmgxb3 T C 18: 61,290,746 (GRCm39) T376A probably benign Het
Hspa12b A G 2: 130,984,977 (GRCm39) D416G probably damaging Het
Immt C T 6: 71,821,659 (GRCm39) R28* probably null Het
Iqgap1 T C 7: 80,412,308 (GRCm39) Y180C probably damaging Het
Kcnq3 T A 15: 65,895,578 (GRCm39) D322V probably damaging Het
Kifc2 C A 15: 76,546,421 (GRCm39) L268I probably benign Het
Lipk A G 19: 33,999,017 (GRCm39) N104S possibly damaging Het
Lrrc14b T A 13: 74,511,876 (GRCm39) N68I possibly damaging Het
Lrrc28 A T 7: 67,181,430 (GRCm39) D268E probably damaging Het
Ly6c2 T C 15: 74,980,392 (GRCm39) *132W probably null Het
Msh6 A G 17: 88,293,516 (GRCm39) E757G probably damaging Het
Mtss2 T C 8: 111,453,015 (GRCm39) V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Nalcn A T 14: 123,607,429 (GRCm39) I680N probably benign Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Odr4 A T 1: 150,264,310 (GRCm39) N66K probably benign Het
Oosp2 A T 19: 11,626,978 (GRCm39) L17* probably null Het
Or10a5 A T 7: 106,635,545 (GRCm39) Y61F possibly damaging Het
Or13a28 C T 7: 140,217,965 (GRCm39) T117M probably damaging Het
Or8b48 T C 9: 38,492,804 (GRCm39) V77A probably benign Het
Or9i2 A C 19: 13,815,946 (GRCm39) V197G probably damaging Het
Pacc1 T G 1: 191,077,306 (GRCm39) F210V probably benign Het
Parvb A G 15: 84,116,369 (GRCm39) K33E possibly damaging Het
Pde4dip T A 3: 97,700,152 (GRCm39) Q300L possibly damaging Het
Phf2 T C 13: 48,958,165 (GRCm39) K950E unknown Het
Pira2 G A 7: 3,847,170 (GRCm39) P124L probably damaging Het
Plpp4 C T 7: 128,981,095 (GRCm39) T157I probably benign Het
Polrmt G A 10: 79,576,109 (GRCm39) Q545* probably null Het
Ptprs A G 17: 56,724,706 (GRCm39) F1511L probably damaging Het
Sbno1 T C 5: 124,540,182 (GRCm39) probably null Het
Setd1a T A 7: 127,385,690 (GRCm39) V256D possibly damaging Het
Slamf1 T C 1: 171,594,840 (GRCm39) S16P probably damaging Het
Slc16a14 T C 1: 84,885,120 (GRCm39) D473G probably damaging Het
Slc8a2 A T 7: 15,893,089 (GRCm39) H917L probably damaging Het
Sorbs2 A C 8: 46,248,480 (GRCm39) D442A probably damaging Het
Srp68 G T 11: 116,151,693 (GRCm39) T301K possibly damaging Het
Stab2 A T 10: 86,700,904 (GRCm39) C457* probably null Het
Stk31 T G 6: 49,416,152 (GRCm39) S652R possibly damaging Het
Stra6 T G 9: 58,059,822 (GRCm39) S594R probably benign Het
Tbc1d9 G A 8: 83,998,078 (GRCm39) E1212K probably damaging Het
Thada C T 17: 84,749,192 (GRCm39) R593Q probably damaging Het
Tmem131 C A 1: 36,851,690 (GRCm39) V938L probably benign Het
Tmem132c T A 5: 127,540,026 (GRCm39) W351R probably damaging Het
Trim10 C T 17: 37,187,906 (GRCm39) A374V probably benign Het
Try10 T C 6: 41,333,495 (GRCm39) V80A probably benign Het
Ttn T C 2: 76,559,707 (GRCm39) T29565A possibly damaging Het
Uggt2 G T 14: 119,312,757 (GRCm39) Q351K probably benign Het
Vmn1r120 A T 7: 20,786,889 (GRCm39) V274D probably damaging Het
Vmn1r62 A T 7: 5,678,358 (GRCm39) H13L probably benign Het
Vmn2r101 C T 17: 19,809,225 (GRCm39) T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vps51 A G 19: 6,118,164 (GRCm39) V777A probably benign Het
Wnt5a A G 14: 28,235,274 (GRCm39) Y86C probably damaging Het
Xpa T C 4: 46,183,189 (GRCm39) E200G probably damaging Het
Zc3h12a C T 4: 125,020,435 (GRCm39) R136K possibly damaging Het
Zc3hav1 T C 6: 38,313,472 (GRCm39) H191R probably damaging Het
Zfp804a A G 2: 82,089,008 (GRCm39) T946A probably benign Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 68,122,923 (GRCm39) missense probably benign
IGL00336:Lama1 APN 17 68,120,943 (GRCm39) missense probably benign 0.07
IGL01066:Lama1 APN 17 68,050,321 (GRCm39) missense probably damaging 1.00
IGL01140:Lama1 APN 17 68,109,928 (GRCm39) missense probably benign 0.14
IGL01291:Lama1 APN 17 68,045,865 (GRCm39) missense probably damaging 1.00
IGL01296:Lama1 APN 17 68,052,046 (GRCm39) missense probably benign 0.27
IGL01317:Lama1 APN 17 68,125,696 (GRCm39) missense probably damaging 1.00
IGL01490:Lama1 APN 17 68,057,579 (GRCm39) missense possibly damaging 0.54
IGL01506:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01508:Lama1 APN 17 68,116,356 (GRCm39) splice site probably benign
IGL01522:Lama1 APN 17 68,059,769 (GRCm39) splice site probably benign
IGL01530:Lama1 APN 17 68,103,785 (GRCm39) missense probably benign 0.02
IGL01541:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01677:Lama1 APN 17 68,086,143 (GRCm39) missense probably benign 0.15
IGL01886:Lama1 APN 17 68,114,792 (GRCm39) missense probably benign 0.36
IGL01994:Lama1 APN 17 68,059,434 (GRCm39) missense probably benign 0.05
IGL02017:Lama1 APN 17 68,071,720 (GRCm39) missense probably benign 0.00
IGL02021:Lama1 APN 17 68,128,621 (GRCm39) missense probably damaging 1.00
IGL02026:Lama1 APN 17 68,116,287 (GRCm39) missense possibly damaging 0.82
IGL02044:Lama1 APN 17 68,118,485 (GRCm39) missense probably benign 0.01
IGL02120:Lama1 APN 17 68,023,784 (GRCm39) missense probably damaging 1.00
IGL02425:Lama1 APN 17 68,118,480 (GRCm39) missense probably benign 0.45
IGL02549:Lama1 APN 17 68,097,830 (GRCm39) missense possibly damaging 0.93
IGL02642:Lama1 APN 17 68,119,361 (GRCm39) missense probably benign 0.00
IGL02795:Lama1 APN 17 68,045,889 (GRCm39) splice site probably null
IGL02798:Lama1 APN 17 68,102,186 (GRCm39) splice site probably benign
IGL02863:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02870:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02876:Lama1 APN 17 68,057,687 (GRCm39) critical splice donor site probably null
IGL02885:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02891:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02978:Lama1 APN 17 68,093,076 (GRCm39) nonsense probably null
IGL03064:Lama1 APN 17 68,086,099 (GRCm39) missense probably benign 0.01
IGL03076:Lama1 APN 17 68,023,794 (GRCm39) missense possibly damaging 0.95
IGL03110:Lama1 APN 17 68,105,981 (GRCm39) missense probably benign 0.04
IGL03143:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03159:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03268:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
ANU05:Lama1 UTSW 17 68,045,865 (GRCm39) missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 68,071,699 (GRCm39) missense
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0050:Lama1 UTSW 17 68,089,051 (GRCm39) missense possibly damaging 0.66
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0111:Lama1 UTSW 17 68,044,493 (GRCm39) missense probably damaging 0.98
R0116:Lama1 UTSW 17 68,083,918 (GRCm39) missense probably benign 0.10
R0121:Lama1 UTSW 17 68,105,508 (GRCm39) splice site probably benign
R0278:Lama1 UTSW 17 68,117,178 (GRCm39) missense probably null 0.98
R0281:Lama1 UTSW 17 68,124,564 (GRCm39) missense probably damaging 1.00
R0312:Lama1 UTSW 17 68,082,846 (GRCm39) missense possibly damaging 0.45
R0419:Lama1 UTSW 17 68,098,605 (GRCm39) critical splice donor site probably null
R0512:Lama1 UTSW 17 68,086,129 (GRCm39) missense possibly damaging 0.67
R0514:Lama1 UTSW 17 68,071,693 (GRCm39) missense probably benign 0.40
R0562:Lama1 UTSW 17 68,122,954 (GRCm39) missense probably damaging 1.00
R0632:Lama1 UTSW 17 68,059,363 (GRCm39) splice site probably benign
R0645:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R0712:Lama1 UTSW 17 68,086,037 (GRCm39) splice site probably null
R0763:Lama1 UTSW 17 68,079,813 (GRCm39) missense probably damaging 0.97
R0941:Lama1 UTSW 17 68,082,860 (GRCm39) missense probably benign 0.10
R1025:Lama1 UTSW 17 68,059,893 (GRCm39) missense probably benign 0.00
R1084:Lama1 UTSW 17 68,111,464 (GRCm39) missense probably benign 0.12
R1103:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1420:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1430:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R1569:Lama1 UTSW 17 68,087,613 (GRCm39) splice site probably null
R1575:Lama1 UTSW 17 68,117,404 (GRCm39) missense possibly damaging 0.96
R1613:Lama1 UTSW 17 68,114,918 (GRCm39) missense probably benign 0.42
R1620:Lama1 UTSW 17 68,074,028 (GRCm39) missense probably benign 0.01
R1629:Lama1 UTSW 17 68,112,423 (GRCm39) missense probably benign 0.00
R1645:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably benign 0.14
R1652:Lama1 UTSW 17 68,114,841 (GRCm39) missense probably damaging 0.97
R1674:Lama1 UTSW 17 68,098,239 (GRCm39) missense probably benign
R1678:Lama1 UTSW 17 68,117,150 (GRCm39) missense possibly damaging 0.56
R1710:Lama1 UTSW 17 68,060,786 (GRCm39) missense probably benign 0.00
R1712:Lama1 UTSW 17 68,024,181 (GRCm39) missense possibly damaging 0.95
R1737:Lama1 UTSW 17 68,109,916 (GRCm39) missense probably benign 0.36
R1757:Lama1 UTSW 17 68,004,378 (GRCm39) missense unknown
R1757:Lama1 UTSW 17 68,070,831 (GRCm39) missense probably benign 0.40
R1813:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1896:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1945:Lama1 UTSW 17 68,052,848 (GRCm39) missense probably benign 0.14
R2086:Lama1 UTSW 17 68,124,618 (GRCm39) missense probably damaging 1.00
R2178:Lama1 UTSW 17 68,076,510 (GRCm39) missense probably benign 0.07
R2183:Lama1 UTSW 17 68,098,004 (GRCm39) missense probably damaging 0.98
R2197:Lama1 UTSW 17 68,059,936 (GRCm39) missense probably benign 0.02
R2213:Lama1 UTSW 17 68,084,029 (GRCm39) nonsense probably null
R2260:Lama1 UTSW 17 68,044,502 (GRCm39) missense probably damaging 0.96
R2356:Lama1 UTSW 17 68,117,109 (GRCm39) missense probably damaging 1.00
R2420:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2421:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2422:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2424:Lama1 UTSW 17 68,105,660 (GRCm39) missense probably benign 0.09
R2442:Lama1 UTSW 17 68,075,312 (GRCm39) missense probably benign 0.04
R3147:Lama1 UTSW 17 68,044,653 (GRCm39) missense probably damaging 0.98
R3414:Lama1 UTSW 17 68,044,598 (GRCm39) missense probably damaging 1.00
R3683:Lama1 UTSW 17 68,075,328 (GRCm39) missense probably benign 0.40
R3820:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3821:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3822:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R4012:Lama1 UTSW 17 68,119,368 (GRCm39) nonsense probably null
R4113:Lama1 UTSW 17 68,071,698 (GRCm39) missense probably benign 0.01
R4133:Lama1 UTSW 17 68,119,481 (GRCm39) missense probably damaging 1.00
R4133:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R4259:Lama1 UTSW 17 68,059,413 (GRCm39) missense possibly damaging 0.95
R4278:Lama1 UTSW 17 68,098,512 (GRCm39) missense probably null 0.00
R4321:Lama1 UTSW 17 68,078,078 (GRCm39) missense probably benign 0.03
R4374:Lama1 UTSW 17 68,111,513 (GRCm39) missense probably benign 0.00
R4386:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R4463:Lama1 UTSW 17 68,068,695 (GRCm39) missense probably damaging 1.00
R4629:Lama1 UTSW 17 68,112,355 (GRCm39) critical splice acceptor site probably null
R4630:Lama1 UTSW 17 68,101,295 (GRCm39) missense probably benign 0.00
R4633:Lama1 UTSW 17 68,105,579 (GRCm39) missense probably damaging 0.96
R4668:Lama1 UTSW 17 68,059,429 (GRCm39) missense probably benign 0.27
R4684:Lama1 UTSW 17 68,080,773 (GRCm39) missense possibly damaging 0.88
R4745:Lama1 UTSW 17 68,045,775 (GRCm39) missense probably damaging 1.00
R4786:Lama1 UTSW 17 68,080,854 (GRCm39) missense possibly damaging 0.77
R4797:Lama1 UTSW 17 68,023,770 (GRCm39) missense probably benign 0.04
R4803:Lama1 UTSW 17 68,116,266 (GRCm39) missense probably damaging 1.00
R4925:Lama1 UTSW 17 68,101,309 (GRCm39) missense probably benign 0.02
R4939:Lama1 UTSW 17 68,044,470 (GRCm39) missense possibly damaging 0.91
R4952:Lama1 UTSW 17 68,074,561 (GRCm39) critical splice donor site probably null
R4975:Lama1 UTSW 17 68,045,829 (GRCm39) missense possibly damaging 0.95
R4977:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably damaging 1.00
R5039:Lama1 UTSW 17 68,052,888 (GRCm39) missense possibly damaging 0.66
R5047:Lama1 UTSW 17 68,050,276 (GRCm39) nonsense probably null
R5195:Lama1 UTSW 17 68,071,795 (GRCm39) missense probably benign 0.13
R5230:Lama1 UTSW 17 68,052,078 (GRCm39) nonsense probably null
R5236:Lama1 UTSW 17 68,111,487 (GRCm39) missense probably benign 0.24
R5254:Lama1 UTSW 17 68,063,711 (GRCm39) missense probably benign 0.01
R5345:Lama1 UTSW 17 68,124,558 (GRCm39) missense probably benign
R5438:Lama1 UTSW 17 68,107,769 (GRCm39) missense possibly damaging 0.92
R5521:Lama1 UTSW 17 68,087,889 (GRCm39) nonsense probably null
R5568:Lama1 UTSW 17 68,075,293 (GRCm39) critical splice acceptor site probably null
R5645:Lama1 UTSW 17 68,109,943 (GRCm39) missense probably damaging 1.00
R5665:Lama1 UTSW 17 68,077,982 (GRCm39) missense probably damaging 1.00
R5727:Lama1 UTSW 17 68,122,219 (GRCm39) missense possibly damaging 0.81
R5757:Lama1 UTSW 17 68,045,782 (GRCm39) missense possibly damaging 0.59
R5795:Lama1 UTSW 17 68,103,722 (GRCm39) missense probably benign 0.02
R5857:Lama1 UTSW 17 68,114,838 (GRCm39) missense probably damaging 0.99
R5894:Lama1 UTSW 17 68,086,042 (GRCm39) critical splice acceptor site probably null
R5974:Lama1 UTSW 17 68,080,722 (GRCm39) missense probably benign 0.31
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6120:Lama1 UTSW 17 68,087,612 (GRCm39) critical splice donor site probably null
R6219:Lama1 UTSW 17 68,097,851 (GRCm39) missense probably benign 0.08
R6224:Lama1 UTSW 17 68,109,982 (GRCm39) missense possibly damaging 0.56
R6249:Lama1 UTSW 17 68,105,599 (GRCm39) missense probably benign
R6265:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R6276:Lama1 UTSW 17 68,091,083 (GRCm39) splice site probably null
R6284:Lama1 UTSW 17 68,117,091 (GRCm39) missense probably damaging 0.99
R6337:Lama1 UTSW 17 68,093,014 (GRCm39) missense probably benign 0.27
R6414:Lama1 UTSW 17 68,053,905 (GRCm39) critical splice donor site probably null
R6631:Lama1 UTSW 17 68,081,477 (GRCm39) missense probably benign 0.21
R6659:Lama1 UTSW 17 68,125,630 (GRCm39) missense probably damaging 1.00
R6660:Lama1 UTSW 17 68,111,495 (GRCm39) missense probably benign 0.05
R6677:Lama1 UTSW 17 68,102,228 (GRCm39) missense probably benign 0.14
R6763:Lama1 UTSW 17 68,053,868 (GRCm39) missense unknown
R6787:Lama1 UTSW 17 68,091,020 (GRCm39) missense unknown
R6831:Lama1 UTSW 17 68,063,749 (GRCm39) missense possibly damaging 0.89
R6855:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R6910:Lama1 UTSW 17 68,098,459 (GRCm39) missense possibly damaging 0.60
R6934:Lama1 UTSW 17 68,081,538 (GRCm39) missense probably benign 0.04
R6945:Lama1 UTSW 17 68,120,861 (GRCm39) missense
R6984:Lama1 UTSW 17 68,086,107 (GRCm39) missense
R6989:Lama1 UTSW 17 68,060,753 (GRCm39) missense
R6994:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R6995:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R7035:Lama1 UTSW 17 68,088,044 (GRCm39) missense
R7133:Lama1 UTSW 17 68,089,141 (GRCm39) missense
R7172:Lama1 UTSW 17 68,111,540 (GRCm39) missense
R7197:Lama1 UTSW 17 68,044,700 (GRCm39) nonsense probably null
R7217:Lama1 UTSW 17 68,071,668 (GRCm39) missense
R7229:Lama1 UTSW 17 68,059,441 (GRCm39) missense
R7264:Lama1 UTSW 17 68,050,292 (GRCm39) missense
R7311:Lama1 UTSW 17 68,074,380 (GRCm39) missense
R7394:Lama1 UTSW 17 68,024,256 (GRCm39) missense
R7419:Lama1 UTSW 17 68,024,169 (GRCm39) missense
R7460:Lama1 UTSW 17 68,074,013 (GRCm39) missense
R7492:Lama1 UTSW 17 68,124,646 (GRCm39) missense
R7494:Lama1 UTSW 17 68,118,441 (GRCm39) missense
R7552:Lama1 UTSW 17 68,044,662 (GRCm39) missense
R7576:Lama1 UTSW 17 68,089,036 (GRCm39) missense
R7583:Lama1 UTSW 17 68,068,616 (GRCm39) missense
R7649:Lama1 UTSW 17 68,044,549 (GRCm39) missense
R7663:Lama1 UTSW 17 68,087,875 (GRCm39) missense
R7667:Lama1 UTSW 17 68,087,592 (GRCm39) missense
R7688:Lama1 UTSW 17 68,068,623 (GRCm39) missense
R7693:Lama1 UTSW 17 68,124,026 (GRCm39) missense
R7748:Lama1 UTSW 17 68,057,585 (GRCm39) missense
R7778:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7824:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7861:Lama1 UTSW 17 68,116,216 (GRCm39) missense
R7884:Lama1 UTSW 17 68,076,430 (GRCm39) missense
R8029:Lama1 UTSW 17 68,124,589 (GRCm39) missense
R8078:Lama1 UTSW 17 68,098,289 (GRCm39) missense
R8101:Lama1 UTSW 17 68,052,917 (GRCm39) missense
R8313:Lama1 UTSW 17 68,057,515 (GRCm39) missense
R8356:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8366:Lama1 UTSW 17 68,125,699 (GRCm39) missense
R8403:Lama1 UTSW 17 68,052,918 (GRCm39) missense
R8456:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8466:Lama1 UTSW 17 68,120,948 (GRCm39) missense
R8678:Lama1 UTSW 17 68,124,098 (GRCm39) missense
R8728:Lama1 UTSW 17 68,125,663 (GRCm39) missense
R8796:Lama1 UTSW 17 68,117,146 (GRCm39) missense
R8885:Lama1 UTSW 17 68,080,779 (GRCm39) missense
R8893:Lama1 UTSW 17 68,112,367 (GRCm39) missense
R8898:Lama1 UTSW 17 68,128,610 (GRCm39) missense
R8909:Lama1 UTSW 17 68,079,736 (GRCm39) missense
R9025:Lama1 UTSW 17 68,119,491 (GRCm39) missense
R9045:Lama1 UTSW 17 68,060,838 (GRCm39) missense
R9098:Lama1 UTSW 17 68,111,508 (GRCm39) missense
R9114:Lama1 UTSW 17 68,128,669 (GRCm39) missense
R9173:Lama1 UTSW 17 68,076,597 (GRCm39) missense
R9190:Lama1 UTSW 17 68,111,514 (GRCm39) missense
R9381:Lama1 UTSW 17 68,044,479 (GRCm39) missense
R9429:Lama1 UTSW 17 68,118,449 (GRCm39) missense
R9504:Lama1 UTSW 17 68,128,661 (GRCm39) missense
R9558:Lama1 UTSW 17 68,124,004 (GRCm39) missense
R9647:Lama1 UTSW 17 68,024,170 (GRCm39) missense
R9651:Lama1 UTSW 17 68,101,215 (GRCm39) missense
R9654:Lama1 UTSW 17 68,101,266 (GRCm39) missense
R9710:Lama1 UTSW 17 68,129,404 (GRCm39) missense
R9733:Lama1 UTSW 17 68,116,940 (GRCm39) missense
RF001:Lama1 UTSW 17 68,059,897 (GRCm39) missense
RF013:Lama1 UTSW 17 68,088,057 (GRCm39) missense
V8831:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
X0024:Lama1 UTSW 17 68,045,883 (GRCm39) missense probably damaging 1.00
X0028:Lama1 UTSW 17 68,101,305 (GRCm39) missense probably benign 0.06
X0028:Lama1 UTSW 17 68,074,417 (GRCm39) missense probably benign 0.00
X0066:Lama1 UTSW 17 68,118,561 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,117,166 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,078,077 (GRCm39) missense probably benign 0.25
Z1088:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1176:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1177:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1191:Lama1 UTSW 17 68,105,639 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGGCTTATGGTGGGAAACTC -3'
(R):5'- GGTGACTTAACATCCAACTCCATG -3'

Sequencing Primer
(F):5'- GAAACTCCAGTACAGTGTGGCTTTC -3'
(R):5'- GCAAACAGCTACTGTCGTTTG -3'
Posted On 2014-10-01