Incidental Mutation 'R2150:Cyp2j11'
ID234178
Institutional Source Beutler Lab
Gene Symbol Cyp2j11
Ensembl Gene ENSMUSG00000066097
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 11
SynonymsCyp2j11-ps
MMRRC Submission 040153-MU
Accession Numbers

Genbank: NM_001004141; MGI: 2140224

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2150 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96294508-96348662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96316358 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 317 (T317I)
Ref Sequence ENSEMBL: ENSMUSP00000132180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015368]
Predicted Effect probably damaging
Transcript: ENSMUST00000015368
AA Change: T317I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132180
Gene: ENSMUSG00000066097
AA Change: T317I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 500 4.3e-133 PFAM
Meta Mutation Damage Score 0.9191 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Cyp2j11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Cyp2j11 APN 4 96339095 missense probably benign
IGL01816:Cyp2j11 APN 4 96294924 missense probably damaging 1.00
IGL02406:Cyp2j11 APN 4 96348539 missense possibly damaging 0.56
E7848:Cyp2j11 UTSW 4 96319365 missense probably benign 0.09
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R1298:Cyp2j11 UTSW 4 96307260 critical splice donor site probably null
R1411:Cyp2j11 UTSW 4 96345216 missense probably benign 0.03
R1428:Cyp2j11 UTSW 4 96294880 missense probably benign 0.01
R1740:Cyp2j11 UTSW 4 96319376 missense probably benign 0.00
R1818:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1819:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1917:Cyp2j11 UTSW 4 96339974 missense probably damaging 1.00
R2084:Cyp2j11 UTSW 4 96339201 missense probably damaging 1.00
R2146:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2148:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R4963:Cyp2j11 UTSW 4 96316382 missense probably damaging 1.00
R5335:Cyp2j11 UTSW 4 96307352 missense probably damaging 1.00
R5450:Cyp2j11 UTSW 4 96339876 missense probably benign 0.44
R5688:Cyp2j11 UTSW 4 96345121 missense probably damaging 1.00
R5978:Cyp2j11 UTSW 4 96319352 missense probably damaging 1.00
R6061:Cyp2j11 UTSW 4 96348616 start gained probably benign
R6075:Cyp2j11 UTSW 4 96345085 missense probably benign 0.04
R6912:Cyp2j11 UTSW 4 96294871 missense probably benign 0.00
R7338:Cyp2j11 UTSW 4 96307287 missense possibly damaging 0.64
R7394:Cyp2j11 UTSW 4 96316440 missense probably benign 0.00
R7464:Cyp2j11 UTSW 4 96345120 missense probably damaging 1.00
R7972:Cyp2j11 UTSW 4 96297634 missense probably damaging 1.00
R8152:Cyp2j11 UTSW 4 96307292 missense probably damaging 1.00
R8328:Cyp2j11 UTSW 4 96348368 missense probably benign 0.03
R8383:Cyp2j11 UTSW 4 96348458 missense probably benign 0.00
R8519:Cyp2j11 UTSW 4 96319302 missense probably benign 0.44
R8789:Cyp2j11 UTSW 4 96339168 missense probably damaging 0.99
Z1176:Cyp2j11 UTSW 4 96307303 missense probably damaging 0.99
Z1176:Cyp2j11 UTSW 4 96307436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCTGCTCTCCAAAACTC -3'
(R):5'- CCAGTTTCAAGACTTCGTTCTTGAG -3'

Sequencing Primer
(F):5'- AACTCCTCAACTCACAGCTATTTC -3'
(R):5'- CAAATTCAGATGGTAGCCCTTGG -3'
Posted On2014-10-01