Incidental Mutation 'R2150:Igsf9b'
ID234196
Institutional Source Beutler Lab
Gene Symbol Igsf9b
Ensembl Gene ENSMUSG00000034275
Gene Nameimmunoglobulin superfamily, member 9B
SynonymsLOC235086
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R2150 (G1)
Quality Score153
Status Validated
Chromosome9
Chromosomal Location27299204-27357546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27334337 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1200 (L1200P)
Ref Sequence ENSEMBL: ENSMUSP00000149356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]
Predicted Effect probably benign
Transcript: ENSMUST00000115247
SMART Domains Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133213
AA Change: L1196P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: L1196P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 30 134 9.41e-9 SMART
IGc2 152 215 1.82e-15 SMART
FN3 232 302 7.02e1 SMART
IGc2 241 310 3.01e-7 SMART
IG 331 417 2.79e-2 SMART
IGc2 433 495 5.48e-10 SMART
FN3 510 591 1.35e-7 SMART
FN3 615 695 3.08e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 835 843 N/A INTRINSIC
low complexity region 971 982 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
low complexity region 1148 1161 N/A INTRINSIC
low complexity region 1172 1190 N/A INTRINSIC
low complexity region 1246 1273 N/A INTRINSIC
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1313 1326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214187
Predicted Effect probably damaging
Transcript: ENSMUST00000214357
AA Change: L1200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1290 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Igsf9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Igsf9b APN 9 27319655 missense probably damaging 1.00
IGL01013:Igsf9b APN 9 27334304 missense probably damaging 1.00
IGL01960:Igsf9b APN 9 27328606 missense possibly damaging 0.93
IGL02398:Igsf9b APN 9 27333130 missense possibly damaging 0.54
IGL03007:Igsf9b APN 9 27333082 missense probably damaging 0.98
IGL03014:Igsf9b UTSW 9 27322636 missense probably benign 0.00
R0127:Igsf9b UTSW 9 27334385 missense possibly damaging 0.65
R0376:Igsf9b UTSW 9 27334582 missense probably benign 0.01
R0520:Igsf9b UTSW 9 27323250 missense probably benign 0.00
R0534:Igsf9b UTSW 9 27333062 intron probably null
R0613:Igsf9b UTSW 9 27326920 missense probably damaging 1.00
R0718:Igsf9b UTSW 9 27323361 critical splice donor site probably null
R0828:Igsf9b UTSW 9 27319605 nonsense probably null
R0879:Igsf9b UTSW 9 27333742 missense probably damaging 1.00
R0882:Igsf9b UTSW 9 27319316 missense probably damaging 0.98
R0987:Igsf9b UTSW 9 27332553 splice site probably null
R1162:Igsf9b UTSW 9 27326889 missense probably benign
R1758:Igsf9b UTSW 9 27334252 missense possibly damaging 0.50
R1760:Igsf9b UTSW 9 27317827 missense possibly damaging 0.82
R1819:Igsf9b UTSW 9 27311593 missense probably damaging 0.98
R1823:Igsf9b UTSW 9 27331732 missense probably damaging 0.96
R1982:Igsf9b UTSW 9 27322239 missense possibly damaging 0.82
R2228:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2229:Igsf9b UTSW 9 27333496 missense probably damaging 1.00
R2250:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R2872:Igsf9b UTSW 9 27322223 missense probably benign 0.11
R3415:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3416:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3417:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R3427:Igsf9b UTSW 9 27334577 missense probably damaging 0.99
R4356:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4357:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4358:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4359:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4379:Igsf9b UTSW 9 27309478 missense possibly damaging 0.95
R4416:Igsf9b UTSW 9 27322917 missense probably damaging 1.00
R4445:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4446:Igsf9b UTSW 9 27334252 missense probably benign 0.13
R4787:Igsf9b UTSW 9 27317456 missense probably benign 0.26
R4887:Igsf9b UTSW 9 27322650 missense probably benign 0.45
R5085:Igsf9b UTSW 9 27317437 missense probably benign 0.03
R5360:Igsf9b UTSW 9 27311672 missense probably damaging 0.98
R5417:Igsf9b UTSW 9 27334276 small insertion probably benign
R5686:Igsf9b UTSW 9 27324179 missense probably damaging 0.99
R5738:Igsf9b UTSW 9 27328530 missense probably damaging 0.98
R5869:Igsf9b UTSW 9 27323235 missense probably benign 0.44
R6304:Igsf9b UTSW 9 27342575 missense probably benign 0.19
R6359:Igsf9b UTSW 9 27309599 missense probably benign 0.25
R6367:Igsf9b UTSW 9 27309525 nonsense probably null
R6556:Igsf9b UTSW 9 27329555 missense probably damaging 1.00
R7058:Igsf9b UTSW 9 27322854 missense probably damaging 0.99
R7165:Igsf9b UTSW 9 27334240 missense probably benign
R7180:Igsf9b UTSW 9 27322668 missense possibly damaging 0.95
R7212:Igsf9b UTSW 9 27331696 missense probably damaging 0.98
R7461:Igsf9b UTSW 9 27334122 missense probably benign 0.10
R7605:Igsf9b UTSW 9 27323312 missense probably damaging 0.98
R7609:Igsf9b UTSW 9 27345890 missense probably benign
R7613:Igsf9b UTSW 9 27334122 missense probably benign 0.10
X0013:Igsf9b UTSW 9 27331725 missense possibly damaging 0.89
X0025:Igsf9b UTSW 9 27309461 missense probably damaging 1.00
X0028:Igsf9b UTSW 9 27334372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTATGCAACCTCTGGTC -3'
(R):5'- AGATCCCGTGGATGATGGTG -3'

Sequencing Primer
(F):5'- TATGCAACCTCTGGTCAGCCAAG -3'
(R):5'- ATCCCGTGGATGATGGTGTTGAC -3'
Posted On2014-10-01