Incidental Mutation 'R2150:Dock2'
ID234207
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2150 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34229472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193]
Predicted Effect probably null
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127846
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
toothskin UTSW 11 34464922 missense probably damaging 1.00
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
R7397:Dock2 UTSW 11 34718989 missense probably benign 0.00
R7464:Dock2 UTSW 11 34695278 missense probably damaging 0.99
R7512:Dock2 UTSW 11 34312542 missense possibly damaging 0.95
R7556:Dock2 UTSW 11 34720951 missense probably benign 0.43
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGGAACAGCAGACTTCCC -3'
(R):5'- TGCTAAGCCCTTATGGTCTGC -3'

Sequencing Primer
(F):5'- GGAACAGCAGACTTCCCCTTCTG -3'
(R):5'- TCATGAGTGACACCAACC -3'
Posted On2014-10-01