Incidental Mutation 'R0196:Il22ra1'
ID 23423
Institutional Source Beutler Lab
Gene Symbol Il22ra1
Ensembl Gene ENSMUSG00000037157
Gene Name interleukin 22 receptor, alpha 1
Synonyms Il22r
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0196 (G1)
Quality Score 219
Status Not validated
Chromosome 4
Chromosomal Location 135728172-135752140 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 135734245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 107 (T107I)
Ref Sequence ENSEMBL: ENSMUSP00000099605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102546]
AlphaFold Q80XZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000102546
AA Change: T107I

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099605
Gene: ENSMUSG00000037157
AA Change: T107I

DomainStartEndE-ValueType
Pfam:Tissue_fac 4 106 1.1e-29 PFAM
Pfam:Interfer-bind 119 214 7.5e-7 PFAM
transmembrane domain 227 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family, and has been shown to be a receptor for interleukin 22 (IL22). IL22 receptor is a protein complex that consists of this protein and interleukin 10 receptor, beta (IL10BR/CRFB4), a subunit also shared by the receptor complex for interleukin 10 (IL10). This gene and interleukin 28 receptor, alpha (IL28RA) form a cytokine receptor gene cluster in the chromosomal region 1p36. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Il22ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Il22ra1 APN 4 135751084 missense possibly damaging 0.84
IGL01480:Il22ra1 APN 4 135744801 missense probably benign 0.03
IGL02533:Il22ra1 APN 4 135744723 missense possibly damaging 0.94
R0137:Il22ra1 UTSW 4 135751006 missense probably benign 0.00
R1647:Il22ra1 UTSW 4 135750460 missense probably damaging 0.98
R1800:Il22ra1 UTSW 4 135748160 missense probably benign 0.10
R1901:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1902:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1903:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1906:Il22ra1 UTSW 4 135751233 missense probably damaging 1.00
R4278:Il22ra1 UTSW 4 135750713 missense possibly damaging 0.93
R4404:Il22ra1 UTSW 4 135737431 missense possibly damaging 0.56
R5001:Il22ra1 UTSW 4 135733104 missense probably damaging 1.00
R6666:Il22ra1 UTSW 4 135750461 missense probably damaging 0.98
R7054:Il22ra1 UTSW 4 135751162 missense probably benign 0.00
R7615:Il22ra1 UTSW 4 135737459 missense probably benign 0.16
R7644:Il22ra1 UTSW 4 135733035 missense probably damaging 1.00
R7754:Il22ra1 UTSW 4 135734250 missense probably benign 0.01
R7808:Il22ra1 UTSW 4 135750796 missense possibly damaging 0.93
R8024:Il22ra1 UTSW 4 135734278 missense probably benign 0.43
R8383:Il22ra1 UTSW 4 135734140 missense probably damaging 1.00
Z1177:Il22ra1 UTSW 4 135737406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAACTGTTCATTCACTGGGCAC -3'
(R):5'- TTTCTCCTGAGGACTGGACTAGGC -3'

Sequencing Primer
(F):5'- ATTCACTGGGCACCCTGC -3'
(R):5'- CTTGGGGACACCTTCTCAGAAAG -3'
Posted On 2013-04-16