Incidental Mutation 'R2151:Hc'
ID234236
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 040154-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R2151 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 34991103 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156049
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,478,875 V47I possibly damaging Het
4930447C04Rik T C 12: 72,907,951 probably null Het
4930579F01Rik A G 3: 138,176,456 probably null Het
Abhd17c G T 7: 84,151,455 H130Q probably damaging Het
Actr10 T A 12: 70,940,801 C27* probably null Het
AF529169 T G 9: 89,602,168 K392T possibly damaging Het
Als2 G A 1: 59,207,789 H564Y probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Cnbp C T 6: 87,845,299 G81D probably damaging Het
Dnah5 T C 15: 28,444,091 Y4012H probably damaging Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Drc3 A T 11: 60,375,157 E224V probably benign Het
Ehd2 T C 7: 15,952,203 K315E probably damaging Het
Eif6 A T 2: 155,822,890 N225K probably benign Het
Epg5 T C 18: 78,027,302 V2264A probably benign Het
Faf2 T C 13: 54,648,407 F126L probably damaging Het
Fam71b A T 11: 46,405,331 K177* probably null Het
Fiz1 T C 7: 5,012,881 S37G possibly damaging Het
Frs3 T C 17: 47,703,062 S227P probably benign Het
Gm21188 C T 13: 120,034,799 C178Y unknown Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gm6370 T A 5: 146,493,641 L212Q probably damaging Het
Gmnc G A 16: 26,960,706 H142Y possibly damaging Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Gpr158 G A 2: 21,827,514 V1142M possibly damaging Het
Gpx6 A G 13: 21,318,971 K185R probably damaging Het
Hdac9 A G 12: 34,390,256 S375P probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klre1 G A 6: 129,580,033 E33K possibly damaging Het
Ldhb C A 6: 142,498,670 V86L possibly damaging Het
Magi3 T A 3: 104,046,882 K713I probably damaging Het
Magi3 T C 3: 104,085,238 Y306C probably damaging Het
Mmp17 T C 5: 129,605,661 Y455H probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Myo1a T C 10: 127,720,181 I969T probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nf1 T A 11: 79,447,570 M1136K possibly damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nov G A 15: 54,752,458 A340T probably benign Het
Nrros A T 16: 32,143,258 M611K probably benign Het
Nsd1 A T 13: 55,291,236 N1692I probably damaging Het
Nuak1 T C 10: 84,409,645 N112S probably benign Het
Odf2l T C 3: 145,149,024 Y488H possibly damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr935 T A 9: 38,994,716 T240S probably damaging Het
Olfr948 T A 9: 39,319,117 I166F probably damaging Het
Otop2 A G 11: 115,329,411 D359G possibly damaging Het
Pi4ka A T 16: 17,367,507 F243Y probably benign Het
Pnmal2 T C 7: 16,945,912 C274R probably benign Het
Ppp1r42 A G 1: 10,003,347 V6A probably benign Het
Prrg4 A G 2: 104,839,388 L128S probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psen2 A G 1: 180,233,664 V278A probably damaging Het
Ptpn13 C A 5: 103,525,785 T538K probably damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rbak A C 5: 143,176,502 D35E possibly damaging Het
Rbms1 C A 2: 60,762,048 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Sacs A G 14: 61,209,640 Y3045C probably damaging Het
Scp2 G T 4: 108,063,944 A23E probably benign Het
Sec16a A T 2: 26,413,745 probably benign Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slfn10-ps T A 11: 83,035,685 noncoding transcript Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Slx T A X: 26,534,389 probably benign Het
Spns3 C A 11: 72,545,961 probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tenm4 G T 7: 96,902,847 V2498F probably damaging Het
Tex2 T C 11: 106,567,335 probably benign Het
Tkfc A T 19: 10,599,057 L154Q probably damaging Het
Tmem57 A G 4: 134,811,223 V470A probably benign Het
Tmem62 A G 2: 120,986,862 H257R probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc38 A G 15: 85,851,601 probably null Het
Ttn A T 2: 76,718,413 Y30135* probably null Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r235 G A 17: 21,262,366 V318I probably benign Het
Vmn2r76 T C 7: 86,230,484 I203V probably benign Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zfp180 A G 7: 24,105,260 H368R probably damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Zfyve27 G T 19: 42,171,731 R62L probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 intron probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGTCGCTTGAATGCAGAAC -3'
(R):5'- TCCGTAGCTTGTGGAAGGAG -3'

Sequencing Primer
(F):5'- CATTTCTCAGTTACAGGAAGACGGC -3'
(R):5'- CTTGTGGAAGGAGTGGATCAACTAC -3'
Posted On2014-10-01