Mutagenetix > Incidental Mutation

Incidental Mutation 'R2151:Hc'

234236

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000026874

Gene Name

hemolytic complement

Synonyms

He, C5, C5a

MMRRC Submission

040154-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.487) question?

Stock #

R2151 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34983331-35061438 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to C at 34991103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028233]

AlphaFold

P06684

Predicted Effect

probably benign
Transcript: ENSMUST00000028233

SMART Domains

Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

Domain	Start	End	E-Value	Type
Pfam:A2M_N	125	219	1.8e-15	PFAM
A2M_N_2	465	612	9.83e-34	SMART
ANATO	702	736	4.73e-12	SMART
A2M	776	863	2.44e-29	SMART
Pfam:A2M_comp	1055	1306	2.3e-68	PFAM
A2M_recep	1423	1513	7.29e-28	SMART
C345C	1553	1665	1.51e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125549

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151628

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153559

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156049

Predicted Effect

probably benign
Transcript: ENSMUST00000156412

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	T	5: 5,478,875	V47I	possibly damaging	Het
4930447C04Rik	T	C	12: 72,907,951		probably null	Het
4930579F01Rik	A	G	3: 138,176,456		probably null	Het
Abhd17c	G	T	7: 84,151,455	H130Q	probably damaging	Het
Actr10	T	A	12: 70,940,801	C27*	probably null	Het
AF529169	T	G	9: 89,602,168	K392T	possibly damaging	Het
Als2	G	A	1: 59,207,789	H564Y	probably damaging	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Bicd2	G	T	13: 49,379,576	C546F	probably damaging	Het
Cnbp	C	T	6: 87,845,299	G81D	probably damaging	Het
Dnah5	T	C	15: 28,444,091	Y4012H	probably damaging	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Drc3	A	T	11: 60,375,157	E224V	probably benign	Het
Ehd2	T	C	7: 15,952,203	K315E	probably damaging	Het
Eif6	A	T	2: 155,822,890	N225K	probably benign	Het
Epg5	T	C	18: 78,027,302	V2264A	probably benign	Het
Faf2	T	C	13: 54,648,407	F126L	probably damaging	Het
Fam71b	A	T	11: 46,405,331	K177*	probably null	Het
Fiz1	T	C	7: 5,012,881	S37G	possibly damaging	Het
Frs3	T	C	17: 47,703,062	S227P	probably benign	Het
Gm21188	C	T	13: 120,034,799	C178Y	unknown	Het
Gm4787	T	A	12: 81,377,219	I722F	probably benign	Het
Gm6370	T	A	5: 146,493,641	L212Q	probably damaging	Het
Gmnc	G	A	16: 26,960,706	H142Y	possibly damaging	Het
Gna15	T	C	10: 81,502,904	Y367C	probably damaging	Het
Gpr158	G	A	2: 21,827,514	V1142M	possibly damaging	Het
Gpx6	A	G	13: 21,318,971	K185R	probably damaging	Het
Hdac9	A	G	12: 34,390,256	S375P	probably damaging	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Klre1	G	A	6: 129,580,033	E33K	possibly damaging	Het
Ldhb	C	A	6: 142,498,670	V86L	possibly damaging	Het
Magi3	T	A	3: 104,046,882	K713I	probably damaging	Het
Magi3	T	C	3: 104,085,238	Y306C	probably damaging	Het
Mmp17	T	C	5: 129,605,661	Y455H	probably benign	Het
Mmp25	T	A	17: 23,631,074	Y504F	probably damaging	Het
Myo1a	T	C	10: 127,720,181	I969T	probably benign	Het
Nedd4l	T	A	18: 65,210,330	H820Q	probably damaging	Het
Nf1	T	A	11: 79,447,570	M1136K	possibly damaging	Het
Nmi	T	C	2: 51,952,543	E179G	probably damaging	Het
Nov	G	A	15: 54,752,458	A340T	probably benign	Het
Nrros	A	T	16: 32,143,258	M611K	probably benign	Het
Nsd1	A	T	13: 55,291,236	N1692I	probably damaging	Het
Nuak1	T	C	10: 84,409,645	N112S	probably benign	Het
Odf2l	T	C	3: 145,149,024	Y488H	possibly damaging	Het
Olfr1204	C	A	2: 88,852,784	P278H	probably damaging	Het
Olfr935	T	A	9: 38,994,716	T240S	probably damaging	Het
Olfr948	T	A	9: 39,319,117	I166F	probably damaging	Het
Otop2	A	G	11: 115,329,411	D359G	possibly damaging	Het
Pi4ka	A	T	16: 17,367,507	F243Y	probably benign	Het
Pnmal2	T	C	7: 16,945,912	C274R	probably benign	Het
Ppp1r42	A	G	1: 10,003,347	V6A	probably benign	Het
Prrg4	A	G	2: 104,839,388	L128S	probably damaging	Het
Prss33	C	T	17: 23,834,843	V87M	probably damaging	Het
Psen2	A	G	1: 180,233,664	V278A	probably damaging	Het
Ptpn13	C	A	5: 103,525,785	T538K	probably damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Rbak	A	C	5: 143,176,502	D35E	possibly damaging	Het
Rbms1	C	A	2: 60,762,048		probably null	Het
Rgs7bp	T	A	13: 104,964,089	N226I	probably damaging	Het
Rnf182	T	A	13: 43,668,423	V150E	probably benign	Het
Sacs	A	G	14: 61,209,640	Y3045C	probably damaging	Het
Scp2	G	T	4: 108,063,944	A23E	probably benign	Het
Sec16a	A	T	2: 26,413,745		probably benign	Het
Slc30a5	A	T	13: 100,803,949	H619Q	probably damaging	Het
Slfn10-ps	T	A	11: 83,035,685		noncoding transcript	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Slx	T	A	X: 26,534,389		probably benign	Het
Spns3	C	A	11: 72,545,961		probably benign	Het
Stxbp1	T	A	2: 32,802,856	I383F	probably damaging	Het
Taf3	C	T	2: 9,951,566	E597K	possibly damaging	Het
Tbcd	A	G	11: 121,603,631	Q1006R	possibly damaging	Het
Tenm4	G	T	7: 96,902,847	V2498F	probably damaging	Het
Tex2	T	C	11: 106,567,335		probably benign	Het
Tkfc	A	T	19: 10,599,057	L154Q	probably damaging	Het
Tmem57	A	G	4: 134,811,223	V470A	probably benign	Het
Tmem62	A	G	2: 120,986,862	H257R	probably damaging	Het
Trpm2	T	C	10: 77,932,179	I829V	probably benign	Het
Ttc38	A	G	15: 85,851,601		probably null	Het
Ttn	A	T	2: 76,718,413	Y30135*	probably null	Het
Ttn	A	G	2: 76,980,133	V17A	probably benign	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn1r230	T	A	17: 20,846,801	M84K	probably damaging	Het
Vmn1r235	G	A	17: 21,262,366	V318I	probably benign	Het
Vmn2r76	T	C	7: 86,230,484	I203V	probably benign	Het
Vmn2r97	A	T	17: 18,947,322	R613*	probably null	Het
Zfp180	A	G	7: 24,105,260	H368R	probably damaging	Het
Zfp407	T	C	18: 84,209,649	D1945G	possibly damaging	Het
Zfyve27	G	T	19: 42,171,731	R62L	probably benign	Het

Other mutations in Hc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Hc	APN	2	34991629	missense	probably benign	0.00
IGL00922:Hc	APN	2	34991668	missense	probably damaging	1.00
IGL01523:Hc	APN	2	35039238	missense	probably benign	0.04
IGL01746:Hc	APN	2	35057326	missense	probably damaging	0.98
IGL01793:Hc	APN	2	35028190	missense	probably damaging	1.00
IGL01972:Hc	APN	2	34983772	missense	probably damaging	1.00
IGL02037:Hc	APN	2	35013519	missense	probably benign	0.16
IGL02048:Hc	APN	2	34996027	missense	probably benign	0.00
IGL02227:Hc	APN	2	35009911	intron	probably benign
IGL02230:Hc	APN	2	35013670	missense	probably benign
IGL02254:Hc	APN	2	34984824	missense	probably damaging	1.00
IGL02363:Hc	APN	2	35000835	missense	probably benign
IGL02650:Hc	APN	2	35000874	missense	possibly damaging	0.49
IGL03053:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03168:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03341:Hc	APN	2	35003377	missense	probably damaging	0.98
PIT4142001:Hc	UTSW	2	35031821	splice site	probably benign
PIT4378001:Hc	UTSW	2	35031864	missense	probably benign	0.13
PIT4508001:Hc	UTSW	2	34984804	missense	probably damaging	0.96
PIT4812001:Hc	UTSW	2	35029452	missense	probably benign	0.16
R0025:Hc	UTSW	2	34986292	missense	probably damaging	1.00
R0053:Hc	UTSW	2	35057275	missense	probably benign	0.32
R0197:Hc	UTSW	2	34984750	missense	probably damaging	1.00
R0218:Hc	UTSW	2	35028074	missense	probably damaging	1.00
R0242:Hc	UTSW	2	35036154	splice site	probably benign
R0496:Hc	UTSW	2	35013571	missense	probably damaging	1.00
R1205:Hc	UTSW	2	35003524	missense	possibly damaging	0.50
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1574:Hc	UTSW	2	35000765	intron	probably benign
R1610:Hc	UTSW	2	35006161	missense	probably benign	0.44
R1640:Hc	UTSW	2	35057324	nonsense	probably null
R1887:Hc	UTSW	2	35034611	missense	probably benign
R1920:Hc	UTSW	2	35029395	splice site	probably benign
R2018:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2019:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2366:Hc	UTSW	2	35013636	missense	probably benign
R4093:Hc	UTSW	2	34983807	nonsense	probably null
R4288:Hc	UTSW	2	35030402	missense	probably damaging	0.98
R4501:Hc	UTSW	2	34997476	splice site	probably null
R4502:Hc	UTSW	2	35006252	missense	probably benign	0.00
R4508:Hc	UTSW	2	35013065	missense	possibly damaging	0.94
R4583:Hc	UTSW	2	35028177	missense	probably benign	0.00
R4686:Hc	UTSW	2	35039248	missense	possibly damaging	0.49
R4776:Hc	UTSW	2	35039734	missense	probably benign	0.12
R4846:Hc	UTSW	2	35019670	missense	probably benign	0.00
R5032:Hc	UTSW	2	35013532	missense	probably benign	0.07
R5089:Hc	UTSW	2	35024890	missense	probably benign	0.01
R5289:Hc	UTSW	2	34996014	critical splice donor site	probably null
R5347:Hc	UTSW	2	35037624	missense	probably benign	0.04
R5356:Hc	UTSW	2	34994995	missense	probably benign	0.00
R5379:Hc	UTSW	2	34991065	missense	probably damaging	1.00
R5403:Hc	UTSW	2	35057434	missense	probably damaging	1.00
R5418:Hc	UTSW	2	35008183	critical splice donor site	probably null
R5450:Hc	UTSW	2	35013038	missense	possibly damaging	0.67
R5494:Hc	UTSW	2	35003539	splice site	probably null
R5713:Hc	UTSW	2	35013531	missense	probably damaging	0.99
R5898:Hc	UTSW	2	34997437	missense	probably benign	0.06
R5925:Hc	UTSW	2	35030450	missense	possibly damaging	0.92
R5942:Hc	UTSW	2	35028125	nonsense	probably null
R5991:Hc	UTSW	2	35006105	missense	possibly damaging	0.91
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6115:Hc	UTSW	2	35013038	missense	probably damaging	1.00
R6234:Hc	UTSW	2	35028046	missense	probably benign
R6264:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
R6313:Hc	UTSW	2	34989839	splice site	probably null
R6525:Hc	UTSW	2	34991224	missense	probably benign	0.06
R6577:Hc	UTSW	2	35032126	missense	probably benign	0.00
R6601:Hc	UTSW	2	35045894	missense	probably benign	0.03
R6916:Hc	UTSW	2	35010032	nonsense	probably null
R7108:Hc	UTSW	2	35039694	missense	probably benign	0.03
R7143:Hc	UTSW	2	35050438	missense	probably benign	0.00
R7388:Hc	UTSW	2	34984847	splice site	probably null
R7468:Hc	UTSW	2	35028051	missense	probably benign	0.00
R7504:Hc	UTSW	2	35061319	missense	not run
R7521:Hc	UTSW	2	35045332	missense	possibly damaging	0.80
R7582:Hc	UTSW	2	34991266	missense	possibly damaging	0.70
R7596:Hc	UTSW	2	35000847	missense	probably damaging	0.96
R7599:Hc	UTSW	2	35050419	missense	probably damaging	1.00
R7692:Hc	UTSW	2	35024149	missense	probably damaging	1.00
R7853:Hc	UTSW	2	35010033	missense	probably damaging	1.00
R7877:Hc	UTSW	2	34997399	nonsense	probably null
R8329:Hc	UTSW	2	35012898	splice site	probably null
R8375:Hc	UTSW	2	34983719	missense	probably benign	0.32
R8477:Hc	UTSW	2	34989170	missense	probably damaging	1.00
R8810:Hc	UTSW	2	35019523	missense	probably benign	0.06
R8888:Hc	UTSW	2	35000849	missense	probably benign	0.00
R8895:Hc	UTSW	2	35000849	missense	probably benign	0.00
R8968:Hc	UTSW	2	35032305	missense	possibly damaging	0.91
R8969:Hc	UTSW	2	35019463	critical splice donor site	probably null
R9146:Hc	UTSW	2	35034559	missense	probably damaging	1.00
R9218:Hc	UTSW	2	35032191	missense	probably damaging	1.00
R9340:Hc	UTSW	2	34986282	missense	probably damaging	0.99
R9396:Hc	UTSW	2	35037603	nonsense	probably null
R9569:Hc	UTSW	2	35036347	missense	probably benign	0.00
R9576:Hc	UTSW	2	34983755	missense	probably benign	0.01
R9706:Hc	UTSW	2	35024184	missense	probably damaging	1.00
X0066:Hc	UTSW	2	34983711	missense	probably damaging	1.00
Z1088:Hc	UTSW	2	35029470	missense	probably benign	0.02
Z1088:Hc	UTSW	2	35008249	missense	possibly damaging	0.94
Z1176:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
Z1177:Hc	UTSW	2	35013610	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCGCTTGAATGCAGAAC -3'
(R):5'- TCCGTAGCTTGTGGAAGGAG -3'

Sequencing Primer
(F):5'- CATTTCTCAGTTACAGGAAGACGGC -3'
(R):5'- CTTGTGGAAGGAGTGGATCAACTAC -3'

Posted On

2014-10-01