Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:Lrrc8c'

23426

Institutional Source

Beutler Lab

Gene Symbol

Lrrc8c

Ensembl Gene

ENSMUSG00000054720

Gene Name

leucine rich repeat containing 8 family, member C

Synonyms

E430036I04Rik

MMRRC Submission

038455-MU

Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105519388-105613018 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105606770 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 137 (V137A)

Ref Sequence

ENSEMBL: ENSMUSP00000114899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]

Predicted Effect

probably benign
Transcript: ENSMUST00000067924
AA Change: V137A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: V137A

Domain	Start	End	E-Value	Type
Pfam:Pannexin_like	1	338	5.7e-152	PFAM
low complexity region	398	407	N/A	INTRINSIC
LRR	588	611	3.97e0	SMART
LRR	613	635	1.81e2	SMART
LRR	636	658	2.2e1	SMART
LRR_TYP	659	682	1.45e-2	SMART
LRR	684	703	3.56e2	SMART
LRR	705	728	2.92e1	SMART
LRR	751	774	1.09e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153754
AA Change: V137A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720
AA Change: V137A

Domain	Start	End	E-Value	Type
Pfam:DUF3733	1	65	4.8e-35	PFAM
low complexity region	78	93	N/A	INTRINSIC
Pfam:DUF3733	99	158	1.7e-26	PFAM

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Lrrc8c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Lrrc8c	APN	5	105607210	missense	probably damaging	0.99
IGL00736:Lrrc8c	APN	5	105607114	missense	probably damaging	1.00
IGL00822:Lrrc8c	APN	5	105608308	missense	probably benign	0.04
IGL02009:Lrrc8c	APN	5	105607391	missense	probably damaging	1.00
IGL02156:Lrrc8c	APN	5	105607493	missense	probably damaging	1.00
IGL02266:Lrrc8c	APN	5	105608248	missense	probably benign	0.30
IGL02268:Lrrc8c	APN	5	105607898	missense	probably damaging	1.00
IGL02487:Lrrc8c	APN	5	105606591	missense	probably benign
IGL02536:Lrrc8c	APN	5	105607172	missense	probably benign	0.00
IGL02672:Lrrc8c	APN	5	105607358	missense	possibly damaging	0.85
IGL02860:Lrrc8c	APN	5	105579615	splice site	probably benign
IGL03395:Lrrc8c	APN	5	105606629	missense	probably benign
P0014:Lrrc8c	UTSW	5	105607244	missense	probably benign	0.06
PIT4504001:Lrrc8c	UTSW	5	105608537	missense	probably benign
PIT4651001:Lrrc8c	UTSW	5	105608323	missense	probably benign	0.04
R0454:Lrrc8c	UTSW	5	105607099	missense	probably damaging	1.00
R0565:Lrrc8c	UTSW	5	105607028	missense	probably damaging	0.98
R0673:Lrrc8c	UTSW	5	105607678	missense	probably damaging	0.99
R0722:Lrrc8c	UTSW	5	105579548	missense	probably damaging	1.00
R0815:Lrrc8c	UTSW	5	105608534	missense	probably damaging	1.00
R1177:Lrrc8c	UTSW	5	105606836	missense	probably benign	0.40
R1411:Lrrc8c	UTSW	5	105608179	missense	probably damaging	0.96
R1486:Lrrc8c	UTSW	5	105607529	missense	probably damaging	1.00
R1551:Lrrc8c	UTSW	5	105608224	missense	probably damaging	1.00
R1662:Lrrc8c	UTSW	5	105606757	missense	probably benign	0.22
R1714:Lrrc8c	UTSW	5	105607291	missense	possibly damaging	0.93
R1770:Lrrc8c	UTSW	5	105606737	missense	probably damaging	1.00
R2104:Lrrc8c	UTSW	5	105607358	missense	possibly damaging	0.85
R2139:Lrrc8c	UTSW	5	105606692	missense	probably damaging	1.00
R4425:Lrrc8c	UTSW	5	105607889	missense	probably benign	0.22
R4670:Lrrc8c	UTSW	5	105608374	missense	probably benign
R4897:Lrrc8c	UTSW	5	105608089	missense	probably benign	0.01
R4968:Lrrc8c	UTSW	5	105607127	missense	probably damaging	1.00
R5114:Lrrc8c	UTSW	5	105607483	missense	probably damaging	1.00
R5580:Lrrc8c	UTSW	5	105607687	missense	probably benign	0.00
R5804:Lrrc8c	UTSW	5	105579557	missense	possibly damaging	0.88
R5918:Lrrc8c	UTSW	5	105608251	missense	possibly damaging	0.68
R6293:Lrrc8c	UTSW	5	105606746	missense	probably damaging	1.00
R6303:Lrrc8c	UTSW	5	105608609	missense	probably benign	0.31
R6304:Lrrc8c	UTSW	5	105608609	missense	probably benign	0.31
R7271:Lrrc8c	UTSW	5	105607987	missense	probably benign	0.02
R7341:Lrrc8c	UTSW	5	105607267	missense	probably damaging	1.00
R7380:Lrrc8c	UTSW	5	105607835	missense	possibly damaging	0.71
R7630:Lrrc8c	UTSW	5	105607702	missense	probably damaging	0.99
R7789:Lrrc8c	UTSW	5	105607200	missense	probably damaging	1.00
R8128:Lrrc8c	UTSW	5	105607622	missense	probably damaging	1.00
R8229:Lrrc8c	UTSW	5	105606536	missense	probably benign	0.00
R8247:Lrrc8c	UTSW	5	105608444	missense	probably damaging	1.00
R8248:Lrrc8c	UTSW	5	105607867	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTTATCAGTACCACTCCGCTGCC -3'
(R):5'- TGACTTGAGAGACTGGGACCTCAC -3'

Sequencing Primer
(F):5'- GCTGCCCCCACCTAAAC -3'
(R):5'- TCGGGACCAGACTGGATG -3'

Posted On

2013-04-16