Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:P3h3'

23432

Institutional Source

Beutler Lab

Gene Symbol

P3h3

Ensembl Gene

ENSMUSG00000023191

Gene Name

prolyl 3-hydroxylase 3

Synonyms

Grcb, Leprel2

MMRRC Submission

038455-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0196 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

124841089-124857752 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124845272 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 583 (N583Y)

Ref Sequence

ENSEMBL: ENSMUSP00000023958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024206] [ENSMUST00000135127]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023958
AA Change: N583Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: N583Y

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	58	76	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	222	242	N/A	INTRINSIC
low complexity region	256	277	N/A	INTRINSIC
P4Hc	460	670	8.51e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000024206

SMART Domains

Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439

Domain	Start	End	E-Value	Type
WD40	44	83	4.91e-8	SMART
WD40	86	125	1.61e-3	SMART
WD40	132	170	5.1e-6	SMART
WD40	173	212	3.99e-8	SMART
WD40	215	254	2.67e-9	SMART
WD40	263	298	2e-1	SMART
WD40	301	340	3.87e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126987

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129225

Predicted Effect

probably benign
Transcript: ENSMUST00000135127

SMART Domains

Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	58	76	N/A	INTRINSIC
low complexity region	127	142	N/A	INTRINSIC
low complexity region	222	242	N/A	INTRINSIC
low complexity region	256	277	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149870

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Cep295	A	T	9: 15,338,213	S469T	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in P3h3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:P3h3	APN	6	124845589	missense	probably benign	0.26
IGL02158:P3h3	APN	6	124853092	missense	probably damaging	1.00
IGL02654:P3h3	APN	6	124845265	missense	possibly damaging	0.95
P0040:P3h3	UTSW	6	124853136	missense	probably damaging	0.99
R0024:P3h3	UTSW	6	124857458	missense	probably benign
R0328:P3h3	UTSW	6	124854306	unclassified	probably benign
R0589:P3h3	UTSW	6	124841681	missense	probably damaging	1.00
R0605:P3h3	UTSW	6	124856035	missense	probably damaging	1.00
R0793:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0794:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0795:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0796:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0853:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0854:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0856:P3h3	UTSW	6	124854933	missense	probably benign	0.00
R0893:P3h3	UTSW	6	124845513	missense	probably damaging	1.00
R1819:P3h3	UTSW	6	124854932	missense	probably benign	0.05
R2100:P3h3	UTSW	6	124845042	missense	probably damaging	1.00
R4332:P3h3	UTSW	6	124842136	missense	probably damaging	1.00
R4461:P3h3	UTSW	6	124845568	missense	probably benign	0.08
R4533:P3h3	UTSW	6	124854408	missense	possibly damaging	0.62
R4829:P3h3	UTSW	6	124841638	utr 3 prime	probably benign
R4840:P3h3	UTSW	6	124850637	missense	possibly damaging	0.82
R4962:P3h3	UTSW	6	124841773	missense	probably benign	0.09
R5014:P3h3	UTSW	6	124855236	missense	probably damaging	1.00
R5591:P3h3	UTSW	6	124854695	unclassified	probably benign
R5691:P3h3	UTSW	6	124855153	missense	probably damaging	1.00
R5777:P3h3	UTSW	6	124855958	missense	probably benign	0.24
R5846:P3h3	UTSW	6	124857194	critical splice donor site	probably null
R6212:P3h3	UTSW	6	124845643	missense	probably benign	0.19
R6254:P3h3	UTSW	6	124845601	missense	probably damaging	1.00
R6320:P3h3	UTSW	6	124854872	missense	probably benign	0.02
R6860:P3h3	UTSW	6	124857368	missense	probably benign	0.01
R7385:P3h3	UTSW	6	124855270	missense	probably damaging	1.00
R7472:P3h3	UTSW	6	124850631	missense	possibly damaging	0.92
R7617:P3h3	UTSW	6	124856006	missense	probably damaging	1.00
R7763:P3h3	UTSW	6	124854432	missense	probably benign	0.00
R7831:P3h3	UTSW	6	124855155	missense	possibly damaging	0.86
R8317:P3h3	UTSW	6	124855153	missense	probably damaging	1.00
R8436:P3h3	UTSW	6	124851078	critical splice donor site	probably null
R8749:P3h3	UTSW	6	124845977	missense	probably damaging	0.99
X0021:P3h3	UTSW	6	124856029	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCGCCTCCCTTGAAGTCATCATTG -3'
(R):5'- TGCCGAAGTGCCATAGAAGGTAAC -3'

Sequencing Primer
(F):5'- CCCTTGAAGTCATCATTGAGGTAGAG -3'
(R):5'- GCAGAAAGTCCCCCACTGG -3'

Posted On

2013-04-16