Incidental Mutation 'R2151:Epg5'
ID 234324
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules 5 autophagy tethering factor
Synonyms 5430411K18Rik
MMRRC Submission 040154-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R2151 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 77981680-78078228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78070517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2264 (V2264A)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably benign
Transcript: ENSMUST00000044622
AA Change: V2264A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V2264A

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T C 12: 72,954,725 (GRCm39) probably null Het
4930579F01Rik A G 3: 137,882,217 (GRCm39) probably null Het
Abhd17c G T 7: 83,800,663 (GRCm39) H130Q probably damaging Het
Actr10 T A 12: 70,987,575 (GRCm39) C27* probably null Het
Als2 G A 1: 59,246,948 (GRCm39) H564Y probably damaging Het
Anxa2r1 C T 13: 120,496,335 (GRCm39) C178Y unknown Het
Art5 A G 7: 101,747,407 (GRCm39) L124P possibly damaging Het
Asap2 A T 12: 21,162,084 (GRCm39) T14S probably damaging Het
Atp2c2 A G 8: 120,482,841 (GRCm39) N901S probably benign Het
Bicd2 G T 13: 49,533,052 (GRCm39) C546F probably damaging Het
Ccn3 G A 15: 54,615,854 (GRCm39) A340T probably benign Het
Cnbp C T 6: 87,822,281 (GRCm39) G81D probably damaging Het
Dnah5 T C 15: 28,444,237 (GRCm39) Y4012H probably damaging Het
Dok5 G A 2: 170,642,816 (GRCm39) G38D probably damaging Het
Drc3 A T 11: 60,265,983 (GRCm39) E224V probably benign Het
Ehd2 T C 7: 15,686,128 (GRCm39) K315E probably damaging Het
Eif6 A T 2: 155,664,810 (GRCm39) N225K probably benign Het
Faf2 T C 13: 54,796,220 (GRCm39) F126L probably damaging Het
Fiz1 T C 7: 5,015,880 (GRCm39) S37G possibly damaging Het
Frs3 T C 17: 48,013,987 (GRCm39) S227P probably benign Het
Garin3 A T 11: 46,296,158 (GRCm39) K177* probably null Het
Gm4787 T A 12: 81,423,993 (GRCm39) I722F probably benign Het
Gm6370 T A 5: 146,430,451 (GRCm39) L212Q probably damaging Het
Gmnc G A 16: 26,779,456 (GRCm39) H142Y possibly damaging Het
Gna15 T C 10: 81,338,738 (GRCm39) Y367C probably damaging Het
Gpr158 G A 2: 21,832,325 (GRCm39) V1142M possibly damaging Het
Gpx6 A G 13: 21,503,141 (GRCm39) K185R probably damaging Het
Hc A C 2: 34,881,115 (GRCm39) probably benign Het
Hdac9 A G 12: 34,440,255 (GRCm39) S375P probably damaging Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Klre1 G A 6: 129,556,996 (GRCm39) E33K possibly damaging Het
Ldhb C A 6: 142,444,396 (GRCm39) V86L possibly damaging Het
Maco1 A G 4: 134,538,534 (GRCm39) V470A probably benign Het
Magi3 T A 3: 103,954,198 (GRCm39) K713I probably damaging Het
Magi3 T C 3: 103,992,554 (GRCm39) Y306C probably damaging Het
Minar1 T G 9: 89,484,221 (GRCm39) K392T possibly damaging Het
Mmp17 T C 5: 129,682,725 (GRCm39) Y455H probably benign Het
Mmp25 T A 17: 23,850,048 (GRCm39) Y504F probably damaging Het
Myo1a T C 10: 127,556,050 (GRCm39) I969T probably benign Het
Nedd4l T A 18: 65,343,401 (GRCm39) H820Q probably damaging Het
Nf1 T A 11: 79,338,396 (GRCm39) M1136K possibly damaging Het
Nmi T C 2: 51,842,555 (GRCm39) E179G probably damaging Het
Nrros A T 16: 31,962,076 (GRCm39) M611K probably benign Het
Nsd1 A T 13: 55,439,049 (GRCm39) N1692I probably damaging Het
Nuak1 T C 10: 84,245,509 (GRCm39) N112S probably benign Het
Odf2l T C 3: 144,854,785 (GRCm39) Y488H possibly damaging Het
Or4c106 C A 2: 88,683,128 (GRCm39) P278H probably damaging Het
Or8g21 T A 9: 38,906,012 (GRCm39) T240S probably damaging Het
Or8g30 T A 9: 39,230,413 (GRCm39) I166F probably damaging Het
Otop2 A G 11: 115,220,237 (GRCm39) D359G possibly damaging Het
Pi4ka A T 16: 17,185,371 (GRCm39) F243Y probably benign Het
Pnma8b T C 7: 16,679,837 (GRCm39) C274R probably benign Het
Ppp1r42 A G 1: 10,073,572 (GRCm39) V6A probably benign Het
Prrg4 A G 2: 104,669,733 (GRCm39) L128S probably damaging Het
Prss33 C T 17: 24,053,817 (GRCm39) V87M probably damaging Het
Psen2 A G 1: 180,061,229 (GRCm39) V278A probably damaging Het
Ptpn13 C A 5: 103,673,651 (GRCm39) T538K probably damaging Het
Pttg1ip2 C T 5: 5,528,875 (GRCm39) V47I possibly damaging Het
Rad51ap2 A G 12: 11,507,986 (GRCm39) H636R probably benign Het
Rbak A C 5: 143,162,257 (GRCm39) D35E possibly damaging Het
Rbms1 C A 2: 60,592,392 (GRCm39) probably null Het
Rgs7bp T A 13: 105,100,597 (GRCm39) N226I probably damaging Het
Rnf182 T A 13: 43,821,899 (GRCm39) V150E probably benign Het
Sacs A G 14: 61,447,089 (GRCm39) Y3045C probably damaging Het
Scp2 G T 4: 107,921,141 (GRCm39) A23E probably benign Het
Sec16a A T 2: 26,303,757 (GRCm39) probably benign Het
Slc30a5 A T 13: 100,940,457 (GRCm39) H619Q probably damaging Het
Slfn10-ps T A 11: 82,926,511 (GRCm39) noncoding transcript Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Slx T A X: 26,489,689 (GRCm39) probably benign Het
Spns3 C A 11: 72,436,787 (GRCm39) probably benign Het
Stxbp1 T A 2: 32,692,868 (GRCm39) I383F probably damaging Het
Taf3 C T 2: 9,956,377 (GRCm39) E597K possibly damaging Het
Tbcd A G 11: 121,494,457 (GRCm39) Q1006R possibly damaging Het
Tenm4 G T 7: 96,552,054 (GRCm39) V2498F probably damaging Het
Tex2 T C 11: 106,458,161 (GRCm39) probably benign Het
Tkfc A T 19: 10,576,421 (GRCm39) L154Q probably damaging Het
Tmem62 A G 2: 120,817,343 (GRCm39) H257R probably damaging Het
Trpm2 T C 10: 77,768,013 (GRCm39) I829V probably benign Het
Ttc38 A G 15: 85,735,802 (GRCm39) probably null Het
Ttn A T 2: 76,548,757 (GRCm39) Y30135* probably null Het
Ttn A G 2: 76,810,477 (GRCm39) V17A probably benign Het
Ubqlnl A T 7: 103,797,890 (GRCm39) C536S probably benign Het
Vmn1r230 T A 17: 21,067,063 (GRCm39) M84K probably damaging Het
Vmn1r235 G A 17: 21,482,628 (GRCm39) V318I probably benign Het
Vmn2r76 T C 7: 85,879,692 (GRCm39) I203V probably benign Het
Vmn2r97 A T 17: 19,167,584 (GRCm39) R613* probably null Het
Zfp180 A G 7: 23,804,685 (GRCm39) H368R probably damaging Het
Zfp407 T C 18: 84,227,774 (GRCm39) D1945G possibly damaging Het
Zfyve27 G T 19: 42,160,170 (GRCm39) R62L probably benign Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78,055,956 (GRCm39) missense probably damaging 1.00
IGL01778:Epg5 APN 18 78,062,489 (GRCm39) missense probably damaging 0.98
IGL01936:Epg5 APN 18 78,028,316 (GRCm39) missense probably damaging 1.00
IGL02189:Epg5 APN 18 78,056,085 (GRCm39) missense probably damaging 0.99
IGL02323:Epg5 APN 18 78,056,047 (GRCm39) nonsense probably null
IGL02567:Epg5 APN 18 78,076,288 (GRCm39) missense probably damaging 1.00
IGL02805:Epg5 APN 18 78,073,406 (GRCm39) splice site probably benign
IGL03282:Epg5 APN 18 78,029,641 (GRCm39) missense probably benign 0.25
stitch UTSW 18 77,991,514 (GRCm39) nonsense probably null
R0011:Epg5 UTSW 18 77,991,698 (GRCm39) missense probably benign
R0172:Epg5 UTSW 18 78,070,574 (GRCm39) missense probably benign 0.00
R0335:Epg5 UTSW 18 78,029,687 (GRCm39) missense probably benign 0.25
R0380:Epg5 UTSW 18 78,004,056 (GRCm39) missense probably damaging 1.00
R0441:Epg5 UTSW 18 78,066,486 (GRCm39) splice site probably benign
R0443:Epg5 UTSW 18 77,999,118 (GRCm39) splice site probably benign
R0445:Epg5 UTSW 18 78,057,399 (GRCm39) missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78,066,580 (GRCm39) missense probably damaging 1.00
R0892:Epg5 UTSW 18 78,011,843 (GRCm39) missense possibly damaging 0.94
R1081:Epg5 UTSW 18 78,002,748 (GRCm39) missense possibly damaging 0.92
R1183:Epg5 UTSW 18 78,003,926 (GRCm39) missense probably damaging 1.00
R1374:Epg5 UTSW 18 78,024,541 (GRCm39) missense probably benign
R1428:Epg5 UTSW 18 78,005,642 (GRCm39) missense probably damaging 1.00
R1727:Epg5 UTSW 18 78,059,030 (GRCm39) missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78,067,205 (GRCm39) missense probably damaging 0.99
R1801:Epg5 UTSW 18 78,026,705 (GRCm39) missense possibly damaging 0.63
R1864:Epg5 UTSW 18 78,018,246 (GRCm39) missense probably damaging 0.99
R1908:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1909:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1916:Epg5 UTSW 18 78,008,236 (GRCm39) missense probably benign 0.00
R1986:Epg5 UTSW 18 78,025,521 (GRCm39) critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78,067,202 (GRCm39) missense probably damaging 0.98
R2080:Epg5 UTSW 18 77,991,960 (GRCm39) missense probably benign 0.01
R2106:Epg5 UTSW 18 78,034,578 (GRCm39) nonsense probably null
R2144:Epg5 UTSW 18 77,997,412 (GRCm39) missense possibly damaging 0.78
R2217:Epg5 UTSW 18 77,992,287 (GRCm39) missense probably benign
R2424:Epg5 UTSW 18 78,011,828 (GRCm39) missense probably benign 0.05
R2909:Epg5 UTSW 18 78,026,691 (GRCm39) missense probably damaging 1.00
R3725:Epg5 UTSW 18 78,060,894 (GRCm39) missense probably benign 0.00
R3899:Epg5 UTSW 18 78,000,725 (GRCm39) missense probably damaging 1.00
R4019:Epg5 UTSW 18 78,073,665 (GRCm39) missense probably damaging 0.98
R4260:Epg5 UTSW 18 78,058,914 (GRCm39) missense probably damaging 1.00
R4260:Epg5 UTSW 18 78,002,336 (GRCm39) missense possibly damaging 0.50
R4448:Epg5 UTSW 18 78,005,676 (GRCm39) missense probably damaging 1.00
R4475:Epg5 UTSW 18 77,991,723 (GRCm39) missense probably benign
R4612:Epg5 UTSW 18 78,025,629 (GRCm39) missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78,056,079 (GRCm39) missense probably benign 0.45
R4767:Epg5 UTSW 18 78,066,498 (GRCm39) missense possibly damaging 0.67
R4779:Epg5 UTSW 18 78,034,580 (GRCm39) missense probably benign 0.01
R4791:Epg5 UTSW 18 77,992,211 (GRCm39) nonsense probably null
R4797:Epg5 UTSW 18 78,073,614 (GRCm39) missense probably benign 0.00
R4812:Epg5 UTSW 18 78,022,399 (GRCm39) missense probably benign 0.01
R4899:Epg5 UTSW 18 78,028,272 (GRCm39) missense probably damaging 1.00
R5000:Epg5 UTSW 18 77,997,376 (GRCm39) missense probably benign
R5031:Epg5 UTSW 18 78,072,163 (GRCm39) missense probably benign 0.00
R5050:Epg5 UTSW 18 78,019,156 (GRCm39) missense possibly damaging 0.55
R5114:Epg5 UTSW 18 78,038,828 (GRCm39) missense probably benign
R5144:Epg5 UTSW 18 78,058,895 (GRCm39) missense probably damaging 1.00
R5209:Epg5 UTSW 18 77,994,497 (GRCm39) missense probably damaging 1.00
R5213:Epg5 UTSW 18 78,058,049 (GRCm39) missense probably benign 0.01
R5270:Epg5 UTSW 18 78,026,778 (GRCm39) missense possibly damaging 0.79
R5324:Epg5 UTSW 18 78,005,660 (GRCm39) missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78,070,712 (GRCm39) missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77,994,422 (GRCm39) missense possibly damaging 0.81
R5593:Epg5 UTSW 18 78,000,689 (GRCm39) missense probably damaging 1.00
R5718:Epg5 UTSW 18 78,029,618 (GRCm39) missense probably damaging 1.00
R5773:Epg5 UTSW 18 78,004,040 (GRCm39) missense probably damaging 1.00
R5828:Epg5 UTSW 18 78,064,066 (GRCm39) missense probably damaging 0.99
R5847:Epg5 UTSW 18 78,073,270 (GRCm39) missense probably benign 0.06
R5858:Epg5 UTSW 18 77,991,514 (GRCm39) nonsense probably null
R5914:Epg5 UTSW 18 78,002,847 (GRCm39) critical splice donor site probably null
R6124:Epg5 UTSW 18 78,073,260 (GRCm39) missense probably benign
R6228:Epg5 UTSW 18 77,991,677 (GRCm39) missense possibly damaging 0.90
R6252:Epg5 UTSW 18 78,028,382 (GRCm39) missense probably damaging 1.00
R6269:Epg5 UTSW 18 77,991,585 (GRCm39) missense probably benign
R6312:Epg5 UTSW 18 78,022,426 (GRCm39) missense possibly damaging 0.72
R6320:Epg5 UTSW 18 78,005,613 (GRCm39) missense probably damaging 1.00
R6328:Epg5 UTSW 18 78,072,179 (GRCm39) missense possibly damaging 0.88
R6430:Epg5 UTSW 18 78,019,100 (GRCm39) missense probably damaging 1.00
R6458:Epg5 UTSW 18 77,991,469 (GRCm39) missense probably benign 0.03
R6852:Epg5 UTSW 18 78,056,106 (GRCm39) missense probably damaging 1.00
R6915:Epg5 UTSW 18 78,022,380 (GRCm39) missense probably benign 0.00
R6930:Epg5 UTSW 18 78,057,378 (GRCm39) missense probably damaging 0.99
R6932:Epg5 UTSW 18 77,991,824 (GRCm39) missense probably benign 0.00
R7127:Epg5 UTSW 18 78,072,140 (GRCm39) missense probably damaging 1.00
R7207:Epg5 UTSW 18 77,992,170 (GRCm39) missense probably damaging 1.00
R7225:Epg5 UTSW 18 78,055,917 (GRCm39) missense probably benign 0.45
R7358:Epg5 UTSW 18 78,002,252 (GRCm39) missense possibly damaging 0.78
R7414:Epg5 UTSW 18 78,026,747 (GRCm39) missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78,066,493 (GRCm39) missense probably benign 0.01
R7535:Epg5 UTSW 18 78,076,141 (GRCm39) missense probably benign 0.18
R7586:Epg5 UTSW 18 78,073,275 (GRCm39) missense probably benign
R7651:Epg5 UTSW 18 78,024,615 (GRCm39) nonsense probably null
R7715:Epg5 UTSW 18 78,011,801 (GRCm39) missense probably damaging 1.00
R7753:Epg5 UTSW 18 77,991,560 (GRCm39) missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78,052,929 (GRCm39) critical splice donor site probably null
R8114:Epg5 UTSW 18 78,073,365 (GRCm39) missense probably benign 0.41
R8124:Epg5 UTSW 18 78,008,211 (GRCm39) missense probably benign 0.05
R8307:Epg5 UTSW 18 78,065,894 (GRCm39) missense probably damaging 1.00
R8458:Epg5 UTSW 18 77,991,946 (GRCm39) missense probably benign 0.00
R8751:Epg5 UTSW 18 78,008,225 (GRCm39) missense probably benign 0.28
R8751:Epg5 UTSW 18 78,008,224 (GRCm39) missense possibly damaging 0.65
R8751:Epg5 UTSW 18 78,008,223 (GRCm39) missense probably benign 0.07
R8888:Epg5 UTSW 18 78,056,086 (GRCm39) missense possibly damaging 0.76
R8971:Epg5 UTSW 18 78,022,434 (GRCm39) missense probably damaging 1.00
R9045:Epg5 UTSW 18 77,992,014 (GRCm39) missense probably damaging 1.00
R9291:Epg5 UTSW 18 78,056,065 (GRCm39) nonsense probably null
R9327:Epg5 UTSW 18 77,991,435 (GRCm39) missense probably benign 0.00
R9365:Epg5 UTSW 18 77,997,957 (GRCm39) missense probably damaging 1.00
R9742:Epg5 UTSW 18 78,024,170 (GRCm39) missense probably damaging 1.00
X0023:Epg5 UTSW 18 78,011,872 (GRCm39) missense probably damaging 0.99
X0060:Epg5 UTSW 18 78,005,700 (GRCm39) missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 78,002,354 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAAAATCCAGGCGTCACCAGG -3'
(R):5'- TCCTTGAAGTAGGCCATGATGC -3'

Sequencing Primer
(F):5'- AGGCCCTTCCTGCTAGTC -3'
(R):5'- AGTAGGCCATGATGCAGGCTTC -3'
Posted On 2014-10-01