Mutagenetix > Incidental Mutation

Incidental Mutation 'R2152:Frem2'

234351

Institutional Source

Beutler Lab

Gene Symbol

Frem2

Ensembl Gene

ENSMUSG00000037016

Gene Name

Fras1 related extracellular matrix protein 2

Synonyms

my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik

MMRRC Submission

040155-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2152 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53513938-53657355 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 53517029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 2996 (R2996*)

Ref Sequence

ENSEMBL: ENSMUSP00000088670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091137]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000091137
AA Change: R2996*

SMART Domains

Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: R2996*

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
Pfam:Cadherin_3	249	388	4.3e-9	PFAM
Pfam:Cadherin_3	376	532	3e-34	PFAM
Pfam:Cadherin_3	516	665	7.5e-24	PFAM
Pfam:Cadherin_3	632	798	1.6e-21	PFAM
Pfam:Cadherin_3	763	910	1.2e-25	PFAM
Pfam:Cadherin_3	879	1027	5.1e-18	PFAM
Pfam:Cadherin_3	1015	1159	2.2e-20	PFAM
CA	1202	1293	4.8e-1	SMART
Pfam:Cadherin_3	1392	1503	9.8e-24	PFAM
Pfam:Cadherin_3	1504	1612	6.2e-28	PFAM
Pfam:Cadherin_3	1613	1743	5.3e-20	PFAM
Calx_beta	1748	1847	1.5e-5	SMART
Calx_beta	1860	1971	9.47e-12	SMART
Calx_beta	1985	2092	1.65e-11	SMART
Calx_beta	2105	2209	1.99e-5	SMART
Calx_beta	2227	2331	6.9e-14	SMART
transmembrane domain	3103	3125	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157311

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199543

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,934	D298V	probably damaging	Het
Ackr3	A	T	1: 90,213,843	Y8F	probably benign	Het
Acy1	T	C	9: 106,435,617	E175G	probably damaging	Het
Add2	T	C	6: 86,098,598	L243P	probably damaging	Het
Adsl	A	G	15: 80,967,662	D407G	probably damaging	Het
Afg3l1	T	G	8: 123,494,836	I478S	probably damaging	Het
Arfrp1	T	C	2: 181,359,694	T108A	probably benign	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Bbs12	G	T	3: 37,321,160	E586*	probably null	Het
Bicd2	G	T	13: 49,379,576	C546F	probably damaging	Het
Bid	A	T	6: 120,900,254	L42Q	probably damaging	Het
Bpifb9a	A	G	2: 154,260,135	K51E	probably benign	Het
Calcr	G	T	6: 3,687,615	T424K	probably benign	Het
Cd46	A	G	1: 195,062,413	I339T	probably benign	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cntn3	A	G	6: 102,206,537	I719T	probably damaging	Het
Cyb5r1	T	C	1: 134,409,625	I163T	possibly damaging	Het
Cyp2d26	A	T	15: 82,792,706		probably null	Het
Dclk1	A	G	3: 55,247,212	Y21C	probably damaging	Het
Dgcr2	G	A	16: 17,891,487		probably null	Het
Dhx38	T	C	8: 109,560,674	S221G	probably benign	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dnah3	C	T	7: 119,952,013	V3028I	probably benign	Het
Dnah6	T	C	6: 73,049,166	Y3448C	probably benign	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Doxl2	T	A	6: 48,976,539	I466N	probably damaging	Het
Epb41l1	A	G	2: 156,514,128	D528G	probably damaging	Het
Fat4	A	T	3: 38,983,395	Y3732F	probably damaging	Het
Fgfr4	A	T	13: 55,166,964	Y640F	probably damaging	Het
Foxo6	T	A	4: 120,268,614	D328V	probably benign	Het
Foxp1	A	G	6: 99,016,541	L134P	probably damaging	Het
Fuk	T	A	8: 110,889,072	T542S	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gcn1l1	T	A	5: 115,609,829	I1765N	probably benign	Het
Gm4787	T	A	12: 81,377,219	I722F	probably benign	Het
Gpc6	G	T	14: 116,926,092	A53S	probably benign	Het
Gtpbp8	A	G	16: 44,740,027		probably null	Het
H2-Q2	T	C	17: 35,345,276		probably null	Het
Hapln2	C	A	3: 88,023,613	R157L	probably benign	Het
Hemgn	C	A	4: 46,396,607	E210*	probably null	Het
Hpse	T	A	5: 100,691,403	K360*	probably null	Het
Iqcj	A	T	3: 68,055,310	E68V	probably damaging	Het
Kat2a	T	C	11: 100,712,346		probably benign	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kcnab1	A	T	3: 65,371,440	I371F	probably damaging	Het
Klhl30	C	A	1: 91,357,824	A356D	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Micu1	G	T	10: 59,863,288	M468I	probably benign	Het
Mrc1	A	G	2: 14,327,864	T1292A	probably damaging	Het
Myh8	G	A	11: 67,294,469	E849K	probably damaging	Het
Myom3	G	T	4: 135,803,233	R1152L	probably benign	Het
Nedd4l	T	A	18: 65,210,330	H820Q	probably damaging	Het
Nlrp4g	T	A	9: 124,353,339		noncoding transcript	Het
Olfr1339	C	T	4: 118,735,249	A240V	possibly damaging	Het
Olfr1413	T	C	1: 92,573,908	S246P	probably damaging	Het
Olfr24	T	C	9: 18,755,095	D180G	probably damaging	Het
Olfr33	G	T	7: 102,713,581	H277Q	probably benign	Het
Olfr435	A	G	6: 43,202,069	I142V	probably benign	Het
Olfr592	A	T	7: 103,186,640	D13V	probably benign	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Olfr969	A	T	9: 39,795,647	I91F	probably benign	Het
Otop1	T	A	5: 38,302,851	M587K	probably damaging	Het
Pgm5	T	A	19: 24,834,815	I118F	probably damaging	Het
Phc2	A	G	4: 128,745,066	*41W	probably null	Het
Piezo2	A	T	18: 63,114,041	M532K	probably damaging	Het
Pjvk	A	T	2: 76,658,369	I295F	probably benign	Het
Popdc2	A	G	16: 38,363,120	N155S	possibly damaging	Het
Ppp4r3a	G	T	12: 101,042,567	N684K	probably damaging	Het
Prpf4b	T	A	13: 34,900,419	M930K	probably benign	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Ptprz1	C	A	6: 23,030,671	L1010I	probably damaging	Het
Rabepk	A	T	2: 34,784,550	D232E	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Rb1	T	C	14: 73,288,725	T169A	probably benign	Het
Rcc2	T	C	4: 140,717,117	L373P	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rrbp1	A	G	2: 143,954,198	L1200P	possibly damaging	Het
Sdk1	A	G	5: 141,792,944	N226D	probably damaging	Het
Selenbp1	G	A	3: 94,944,130	R398H	probably damaging	Het
Selenoo	A	G	15: 89,099,282	M509V	probably benign	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc2a5	T	G	4: 150,125,638	S27A	probably damaging	Het
Slc30a5	A	T	13: 100,803,949	H619Q	probably damaging	Het
Slc5a9	A	G	4: 111,893,223	I146T	possibly damaging	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Snx29	A	G	16: 11,400,843	D181G	possibly damaging	Het
Spata31d1c	G	A	13: 65,033,965		probably null	Het
Stat5a	C	A	11: 100,874,090	T213N	probably benign	Het
Stt3a	A	T	9: 36,747,996	V349D	probably damaging	Het
Tcf20	A	T	15: 82,855,602	D549E	probably damaging	Het
Thbs2	T	A	17: 14,673,209	D903V	probably damaging	Het
Tln2	T	C	9: 67,302,560	T432A	probably damaging	Het
Tmc1	A	T	19: 20,856,675	N241K	probably benign	Het
Tmem260	G	T	14: 48,477,609	R240L	possibly damaging	Het
Tnfaip6	A	T	2: 52,043,730	E32D	probably damaging	Het
Trpa1	A	T	1: 14,899,401	H381Q	probably damaging	Het
Tsen2	T	C	6: 115,547,975	I45T	possibly damaging	Het
Ttc6	G	A	12: 57,705,552	V1415I	probably damaging	Het
Ttll7	G	T	3: 146,930,189	R426L	probably damaging	Het
Ttn	A	C	2: 76,740,138	S26804A	probably damaging	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn2r73	A	G	7: 85,857,728	V792A	probably benign	Het
Zfp345	T	C	2: 150,472,658	T320A	probably benign	Het
Zfp407	T	C	18: 84,209,649	D1945G	possibly damaging	Het

Other mutations in Frem2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Frem2	APN	3	53585595	missense	probably damaging	1.00
IGL00911:Frem2	APN	3	53572462	missense	probably damaging	1.00
IGL01322:Frem2	APN	3	53541038	missense	probably benign	0.00
IGL01330:Frem2	APN	3	53655241	missense	possibly damaging	0.70
IGL01406:Frem2	APN	3	53525896	missense	probably damaging	1.00
IGL01556:Frem2	APN	3	53535281	missense	probably benign	0.23
IGL01580:Frem2	APN	3	53655175	missense	probably damaging	1.00
IGL01606:Frem2	APN	3	53653591	missense	possibly damaging	0.69
IGL01611:Frem2	APN	3	53655709	missense	probably benign	0.00
IGL01648:Frem2	APN	3	53535732	missense	possibly damaging	0.86
IGL01663:Frem2	APN	3	53517013	missense	probably damaging	1.00
IGL01665:Frem2	APN	3	53549662	missense	probably benign	0.07
IGL01670:Frem2	APN	3	53656937	missense	possibly damaging	0.95
IGL01960:Frem2	APN	3	53522304	missense	probably benign	0.33
IGL02175:Frem2	APN	3	53655599	missense	possibly damaging	0.69
IGL02201:Frem2	APN	3	53519640	missense	probably benign	0.35
IGL02202:Frem2	APN	3	53654799	missense	probably benign	0.00
IGL02427:Frem2	APN	3	53535763	missense	probably damaging	0.97
IGL02457:Frem2	APN	3	53521049	missense	probably damaging	0.99
IGL02638:Frem2	APN	3	53551346	missense	possibly damaging	0.94
IGL02801:Frem2	APN	3	53652175	missense	possibly damaging	0.85
IGL03023:Frem2	APN	3	53655628	missense	probably benign	0.40
IGL03169:Frem2	APN	3	53522292	missense	probably benign	0.01
IGL03238:Frem2	APN	3	53656261	missense	possibly damaging	0.93
IGL03251:Frem2	APN	3	53572308	missense	probably benign	0.01
IGL03273:Frem2	APN	3	53537509	nonsense	probably null
IGL03343:Frem2	APN	3	53652253	missense	probably damaging	1.00
Biosimilar	UTSW	3	53654323	missense	probably benign	0.01
Fruit_stripe	UTSW	3	53537489	missense	probably benign	0.21
PIT4366001:Frem2	UTSW	3	53653201	missense	probably damaging	0.98
R0019:Frem2	UTSW	3	53523678	missense	probably damaging	0.99
R0092:Frem2	UTSW	3	53589796	missense	probably benign	0.03
R0108:Frem2	UTSW	3	53647961	missense	probably benign	0.03
R0115:Frem2	UTSW	3	53656208	missense	probably damaging	0.99
R0118:Frem2	UTSW	3	53535243	nonsense	probably null
R0374:Frem2	UTSW	3	53653960	missense	probably damaging	1.00
R0437:Frem2	UTSW	3	53653015	missense	possibly damaging	0.96
R0531:Frem2	UTSW	3	53519954	missense	probably damaging	1.00
R0555:Frem2	UTSW	3	53516860	missense	probably damaging	0.97
R0564:Frem2	UTSW	3	53656109	missense	probably damaging	0.97
R0586:Frem2	UTSW	3	53647921	missense	probably damaging	0.99
R0726:Frem2	UTSW	3	53519626	missense	possibly damaging	0.89
R0925:Frem2	UTSW	3	53653973	missense	probably benign
R1233:Frem2	UTSW	3	53547778	missense	probably damaging	0.98
R1302:Frem2	UTSW	3	53655538	missense	probably benign	0.00
R1333:Frem2	UTSW	3	53549731	missense	probably benign	0.26
R1446:Frem2	UTSW	3	53654596	missense	probably benign	0.31
R1523:Frem2	UTSW	3	53655407	missense	possibly damaging	0.73
R1539:Frem2	UTSW	3	53654210	missense	probably benign	0.19
R1543:Frem2	UTSW	3	53572455	missense	possibly damaging	0.86
R1597:Frem2	UTSW	3	53654519	missense	probably benign	0.19
R1600:Frem2	UTSW	3	53547723	missense	probably damaging	1.00
R1678:Frem2	UTSW	3	53519938	missense	probably damaging	1.00
R1687:Frem2	UTSW	3	53653952	missense	probably benign
R1696:Frem2	UTSW	3	53656042	nonsense	probably null
R1758:Frem2	UTSW	3	53653357	missense	probably damaging	1.00
R1857:Frem2	UTSW	3	53654873	missense	probably benign	0.10
R1869:Frem2	UTSW	3	53535196	missense	probably benign	0.04
R1921:Frem2	UTSW	3	53653495	missense	possibly damaging	0.76
R1973:Frem2	UTSW	3	53652232	missense	probably benign	0.01
R2045:Frem2	UTSW	3	53535744	missense	probably damaging	1.00
R2113:Frem2	UTSW	3	53652922	missense	probably damaging	1.00
R2164:Frem2	UTSW	3	53537330	missense	probably damaging	1.00
R2181:Frem2	UTSW	3	53574587	missense	possibly damaging	0.72
R2201:Frem2	UTSW	3	53516573	missense	probably benign
R2221:Frem2	UTSW	3	53516857	missense	probably benign	0.00
R2255:Frem2	UTSW	3	53652514	missense	probably damaging	0.96
R2280:Frem2	UTSW	3	53572423	missense	probably damaging	1.00
R3196:Frem2	UTSW	3	53537331	missense	probably damaging	1.00
R3716:Frem2	UTSW	3	53572360	missense	probably damaging	1.00
R3807:Frem2	UTSW	3	53653449	missense	probably benign	0.22
R3820:Frem2	UTSW	3	53516849	missense	probably damaging	1.00
R3821:Frem2	UTSW	3	53652415	missense	probably damaging	1.00
R3977:Frem2	UTSW	3	53652070	missense	probably benign	0.00
R3979:Frem2	UTSW	3	53652070	missense	probably benign	0.00
R4014:Frem2	UTSW	3	53652353	missense	probably benign	0.01
R4127:Frem2	UTSW	3	53525896	missense	probably damaging	1.00
R4195:Frem2	UTSW	3	53539268	missense	possibly damaging	0.90
R4196:Frem2	UTSW	3	53539268	missense	possibly damaging	0.90
R4374:Frem2	UTSW	3	53545502	missense	possibly damaging	0.61
R4427:Frem2	UTSW	3	53539162	critical splice donor site	probably null
R4428:Frem2	UTSW	3	53654338	missense	probably benign	0.40
R4559:Frem2	UTSW	3	53654321	missense	probably benign	0.01
R4600:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4602:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4610:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4611:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4661:Frem2	UTSW	3	53655443	missense	probably damaging	1.00
R4678:Frem2	UTSW	3	53544371	missense	probably benign	0.00
R4689:Frem2	UTSW	3	53547635	missense	probably benign	0.43
R4740:Frem2	UTSW	3	53535819	missense	probably benign	0.04
R4748:Frem2	UTSW	3	53541093	missense	probably damaging	1.00
R4790:Frem2	UTSW	3	53516741	missense	probably benign
R4809:Frem2	UTSW	3	53653895	missense	probably benign	0.01
R4930:Frem2	UTSW	3	53656315	missense	possibly damaging	0.93
R4971:Frem2	UTSW	3	53539183	missense	probably damaging	1.00
R5057:Frem2	UTSW	3	53535196	missense	probably benign	0.37
R5202:Frem2	UTSW	3	53551346	missense	probably benign	0.41
R5221:Frem2	UTSW	3	53585611	missense	probably damaging	1.00
R5231:Frem2	UTSW	3	53522295	missense	probably damaging	1.00
R5268:Frem2	UTSW	3	53653154	missense	probably damaging	0.96
R5480:Frem2	UTSW	3	53656507	nonsense	probably null
R5637:Frem2	UTSW	3	53652937	missense	probably damaging	0.97
R5664:Frem2	UTSW	3	53652490	missense	probably benign	0.33
R5698:Frem2	UTSW	3	53652505	missense	possibly damaging	0.89
R5744:Frem2	UTSW	3	53655959	missense	probably damaging	1.00
R5754:Frem2	UTSW	3	53537258	missense	probably damaging	1.00
R5808:Frem2	UTSW	3	53652563	missense	probably damaging	0.96
R5840:Frem2	UTSW	3	53647921	missense	probably damaging	0.99
R5874:Frem2	UTSW	3	53537489	missense	probably benign	0.21
R6050:Frem2	UTSW	3	53653012	missense	probably damaging	0.99
R6103:Frem2	UTSW	3	53549788	missense	probably benign	0.00
R6149:Frem2	UTSW	3	53551341	missense	probably damaging	0.98
R6182:Frem2	UTSW	3	53647969	missense	probably damaging	1.00
R6191:Frem2	UTSW	3	53655280	missense	probably benign	0.10
R6245:Frem2	UTSW	3	53655824	missense	probably benign	0.00
R6252:Frem2	UTSW	3	53572448	missense	probably damaging	1.00
R6393:Frem2	UTSW	3	53585640	missense	possibly damaging	0.91
R6416:Frem2	UTSW	3	53572378	missense	probably benign	0.01
R6595:Frem2	UTSW	3	53549784	missense	probably damaging	1.00
R6665:Frem2	UTSW	3	53654656	missense	probably damaging	1.00
R6708:Frem2	UTSW	3	53585501	missense	probably benign	0.00
R6751:Frem2	UTSW	3	53653665	missense	probably damaging	1.00
R6787:Frem2	UTSW	3	53654323	missense	probably benign	0.01
R6913:Frem2	UTSW	3	53516821	missense	probably damaging	1.00
R6916:Frem2	UTSW	3	53547688	missense	probably damaging	1.00
R7017:Frem2	UTSW	3	53519602	missense	probably benign	0.02
R7083:Frem2	UTSW	3	53537493	missense	probably damaging	0.99
R7108:Frem2	UTSW	3	53653513	missense	probably damaging	1.00
R7133:Frem2	UTSW	3	53572339	missense	possibly damaging	0.82
R7326:Frem2	UTSW	3	53654753	missense	probably damaging	1.00
R7341:Frem2	UTSW	3	53654495	missense	probably damaging	1.00
R7455:Frem2	UTSW	3	53572280	splice site	probably null
R7487:Frem2	UTSW	3	53654549	missense	probably benign	0.40
R7495:Frem2	UTSW	3	53516837	missense	probably benign	0.13
R7542:Frem2	UTSW	3	53652579	missense	probably damaging	1.00
R7636:Frem2	UTSW	3	53653247	missense	probably benign	0.00
R7703:Frem2	UTSW	3	53522168	missense	probably benign	0.01
R7750:Frem2	UTSW	3	53523682	missense	possibly damaging	0.83
R7849:Frem2	UTSW	3	53572374	missense	probably damaging	1.00
R7922:Frem2	UTSW	3	53653304	missense	probably damaging	0.98
R8008:Frem2	UTSW	3	53652910	missense	probably damaging	1.00
R8051:Frem2	UTSW	3	53535355	missense	probably benign	0.04
R8052:Frem2	UTSW	3	53549643	missense	probably benign	0.02
R8176:Frem2	UTSW	3	53655340	missense	possibly damaging	0.50
R8220:Frem2	UTSW	3	53656507	nonsense	probably null
R8397:Frem2	UTSW	3	53653141	missense	probably benign	0.00
R8410:Frem2	UTSW	3	53539177	missense	possibly damaging	0.60
R8697:Frem2	UTSW	3	53525828	missense	probably damaging	0.99
R9134:Frem2	UTSW	3	53654900	missense	probably damaging	1.00
R9183:Frem2	UTSW	3	53520065	missense	probably damaging	1.00
R9260:Frem2	UTSW	3	53652783	missense	probably damaging	1.00
R9267:Frem2	UTSW	3	53657083	start codon destroyed	probably null	0.00
R9299:Frem2	UTSW	3	53656559	missense	probably benign	0.37
R9378:Frem2	UTSW	3	53651989	missense	probably damaging	0.99
R9444:Frem2	UTSW	3	53652844	missense	probably benign	0.10
R9459:Frem2	UTSW	3	53653486	missense	probably benign
R9487:Frem2	UTSW	3	53653484	missense	possibly damaging	0.95
R9728:Frem2	UTSW	3	53656631	missense	probably benign	0.00
R9759:Frem2	UTSW	3	53655497	missense	possibly damaging	0.76
Z1177:Frem2	UTSW	3	53535166	missense	probably null	1.00
Z1177:Frem2	UTSW	3	53655607	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GGTTGTTCTCAGCACCGATC -3'
(R):5'- TAAGAGCCTGAGATTGAGCCCC -3'

Sequencing Primer
(F):5'- AGCACCGATCTCCCCTG -3'
(R):5'- ACACCAAGTGTATTATGGAGTTGGC -3'

Posted On

2014-10-01