Incidental Mutation 'R2152:Ttll7'
ID 234358
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Name tubulin tyrosine ligase-like family, member 7
Synonyms 1110049N09Rik, 4921517B04Rik
MMRRC Submission 040155-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.519) question?
Stock # R2152 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 146558122-146689764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 146635944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 426 (R426L)
Ref Sequence ENSEMBL: ENSMUSP00000129369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000037942
AA Change: R426L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106134
AA Change: R426L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: R426L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170055
AA Change: R426L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: R426L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr3 A T 1: 90,141,565 (GRCm39) Y8F probably benign Het
Acy1 T C 9: 106,312,816 (GRCm39) E175G probably damaging Het
Add2 T C 6: 86,075,580 (GRCm39) L243P probably damaging Het
Adsl A G 15: 80,851,863 (GRCm39) D407G probably damaging Het
Afg3l1 T G 8: 124,221,575 (GRCm39) I478S probably damaging Het
Aoc1l1 T A 6: 48,953,473 (GRCm39) I466N probably damaging Het
Arfrp1 T C 2: 181,001,487 (GRCm39) T108A probably benign Het
Art5 A G 7: 101,747,407 (GRCm39) L124P possibly damaging Het
Asap2 A T 12: 21,162,084 (GRCm39) T14S probably damaging Het
Atp2c2 A G 8: 120,482,841 (GRCm39) N901S probably benign Het
Bbs12 G T 3: 37,375,309 (GRCm39) E586* probably null Het
Bicd2 G T 13: 49,533,052 (GRCm39) C546F probably damaging Het
Bid A T 6: 120,877,215 (GRCm39) L42Q probably damaging Het
Bpifb9a A G 2: 154,102,055 (GRCm39) K51E probably benign Het
Calcr G T 6: 3,687,615 (GRCm39) T424K probably benign Het
Cd46 A G 1: 194,744,721 (GRCm39) I339T probably benign Het
Chek1 C A 9: 36,635,279 (GRCm39) V35F probably damaging Het
Cntn3 A G 6: 102,183,498 (GRCm39) I719T probably damaging Het
Cyb5r1 T C 1: 134,337,363 (GRCm39) I163T possibly damaging Het
Cyp2d26 A T 15: 82,676,907 (GRCm39) probably null Het
Dclk1 A G 3: 55,154,633 (GRCm39) Y21C probably damaging Het
Dgcr2 G A 16: 17,709,351 (GRCm39) probably null Het
Dhx38 T C 8: 110,287,306 (GRCm39) S221G probably benign Het
Dis3l T A 9: 64,214,545 (GRCm39) N981I probably benign Het
Dnah3 C T 7: 119,551,236 (GRCm39) V3028I probably benign Het
Dnah6 T C 6: 73,026,149 (GRCm39) Y3448C probably benign Het
Dok5 G A 2: 170,642,816 (GRCm39) G38D probably damaging Het
Epb41l1 A G 2: 156,356,048 (GRCm39) D528G probably damaging Het
Fat4 A T 3: 39,037,544 (GRCm39) Y3732F probably damaging Het
Fcsk T A 8: 111,615,704 (GRCm39) T542S probably benign Het
Fgfr4 A T 13: 55,314,777 (GRCm39) Y640F probably damaging Het
Foxo6 T A 4: 120,125,811 (GRCm39) D328V probably benign Het
Foxp1 A G 6: 98,993,502 (GRCm39) L134P probably damaging Het
Frem2 G A 3: 53,424,450 (GRCm39) R2996* probably null Het
Garem2 T C 5: 30,313,297 (GRCm39) S54P probably damaging Het
Gcn1 T A 5: 115,747,888 (GRCm39) I1765N probably benign Het
Gm4787 T A 12: 81,423,993 (GRCm39) I722F probably benign Het
Gpc6 G T 14: 117,163,504 (GRCm39) A53S probably benign Het
Gtpbp8 A G 16: 44,560,390 (GRCm39) probably null Het
H2-Q2 T C 17: 35,564,252 (GRCm39) probably null Het
Hapln2 C A 3: 87,930,920 (GRCm39) R157L probably benign Het
Hemgn C A 4: 46,396,607 (GRCm39) E210* probably null Het
Hpse T A 5: 100,839,269 (GRCm39) K360* probably null Het
Iqcj A T 3: 67,962,643 (GRCm39) E68V probably damaging Het
Kat2a T C 11: 100,603,172 (GRCm39) probably benign Het
Kat6b A T 14: 21,718,735 (GRCm39) H1138L probably benign Het
Kcnab1 A T 3: 65,278,861 (GRCm39) I371F probably damaging Het
Klhl30 C A 1: 91,285,546 (GRCm39) A356D probably benign Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Micu1 G T 10: 59,699,110 (GRCm39) M468I probably benign Het
Mrc1 A G 2: 14,332,675 (GRCm39) T1292A probably damaging Het
Myh8 G A 11: 67,185,295 (GRCm39) E849K probably damaging Het
Myom3 G T 4: 135,530,544 (GRCm39) R1152L probably benign Het
Nedd4l T A 18: 65,343,401 (GRCm39) H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 (GRCm38) noncoding transcript Het
Oga A T 19: 45,746,461 (GRCm39) Y779* probably null Het
Or13p5 C T 4: 118,592,446 (GRCm39) A240V possibly damaging Het
Or1m1 T C 9: 18,666,391 (GRCm39) D180G probably damaging Het
Or2a51 A G 6: 43,179,003 (GRCm39) I142V probably benign Het
Or51a39 G T 7: 102,362,788 (GRCm39) H277Q probably benign Het
Or52j3 A T 7: 102,835,847 (GRCm39) D13V probably benign Het
Or8b49 G T 9: 38,505,707 (GRCm39) L63F probably damaging Het
Or8g54 A T 9: 39,706,943 (GRCm39) I91F probably benign Het
Or9s23 T C 1: 92,501,630 (GRCm39) S246P probably damaging Het
Otop1 T A 5: 38,460,194 (GRCm39) M587K probably damaging Het
Pgm5 T A 19: 24,812,179 (GRCm39) I118F probably damaging Het
Phc2 A G 4: 128,638,859 (GRCm39) *41W probably null Het
Phf8-ps T A 17: 33,285,908 (GRCm39) D298V probably damaging Het
Piezo2 A T 18: 63,247,112 (GRCm39) M532K probably damaging Het
Pjvk A T 2: 76,488,713 (GRCm39) I295F probably benign Het
Popdc2 A G 16: 38,183,482 (GRCm39) N155S possibly damaging Het
Ppp4r3a G T 12: 101,008,826 (GRCm39) N684K probably damaging Het
Prpf4b T A 13: 35,084,402 (GRCm39) M930K probably benign Het
Ptpn12 C A 5: 21,207,466 (GRCm39) Q297H probably damaging Het
Ptprz1 C A 6: 23,030,670 (GRCm39) L1010I probably damaging Het
Rabepk A T 2: 34,674,562 (GRCm39) D232E possibly damaging Het
Rad51ap2 A G 12: 11,507,986 (GRCm39) H636R probably benign Het
Rb1 T C 14: 73,526,165 (GRCm39) T169A probably benign Het
Rcc2 T C 4: 140,444,428 (GRCm39) L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rrbp1 A G 2: 143,796,118 (GRCm39) L1200P possibly damaging Het
Sdk1 A G 5: 141,778,699 (GRCm39) N226D probably damaging Het
Selenbp1 G A 3: 94,851,441 (GRCm39) R398H probably damaging Het
Selenoo A G 15: 88,983,485 (GRCm39) M509V probably benign Het
Sidt2 T C 9: 45,856,638 (GRCm39) D477G probably damaging Het
Slc2a5 T G 4: 150,210,095 (GRCm39) S27A probably damaging Het
Slc30a5 A T 13: 100,940,457 (GRCm39) H619Q probably damaging Het
Slc5a9 A G 4: 111,750,420 (GRCm39) I146T possibly damaging Het
Slc6a1 G T 6: 114,284,731 (GRCm39) G263V probably damaging Het
Slmap A G 14: 26,139,402 (GRCm39) Y771H probably damaging Het
Snx29 A G 16: 11,218,707 (GRCm39) D181G possibly damaging Het
Spata31d1c G A 13: 65,181,779 (GRCm39) probably null Het
Stat5a C A 11: 100,764,916 (GRCm39) T213N probably benign Het
Stt3a A T 9: 36,659,292 (GRCm39) V349D probably damaging Het
Tcf20 A T 15: 82,739,803 (GRCm39) D549E probably damaging Het
Thbs2 T A 17: 14,893,471 (GRCm39) D903V probably damaging Het
Tln2 T C 9: 67,209,842 (GRCm39) T432A probably damaging Het
Tmc1 A T 19: 20,834,039 (GRCm39) N241K probably benign Het
Tmem260 G T 14: 48,715,066 (GRCm39) R240L possibly damaging Het
Tnfaip6 A T 2: 51,933,742 (GRCm39) E32D probably damaging Het
Trpa1 A T 1: 14,969,625 (GRCm39) H381Q probably damaging Het
Tsen2 T C 6: 115,524,936 (GRCm39) I45T possibly damaging Het
Ttc6 G A 12: 57,752,338 (GRCm39) V1415I probably damaging Het
Ttn A C 2: 76,570,482 (GRCm39) S26804A probably damaging Het
Ubqlnl A T 7: 103,797,890 (GRCm39) C536S probably benign Het
Vmn2r73 A G 7: 85,506,936 (GRCm39) V792A probably benign Het
Zfp345 T C 2: 150,314,578 (GRCm39) T320A probably benign Het
Zfp407 T C 18: 84,227,774 (GRCm39) D1945G possibly damaging Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146,615,337 (GRCm39) missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146,667,474 (GRCm39) missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146,615,354 (GRCm39) missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146,645,776 (GRCm39) missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146,602,445 (GRCm39) missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146,615,408 (GRCm39) missense probably benign 0.06
P0038:Ttll7 UTSW 3 146,650,939 (GRCm39) missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146,649,915 (GRCm39) nonsense probably null
R0358:Ttll7 UTSW 3 146,649,871 (GRCm39) missense probably benign
R0363:Ttll7 UTSW 3 146,649,970 (GRCm39) missense probably benign 0.00
R0364:Ttll7 UTSW 3 146,650,936 (GRCm39) missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146,645,746 (GRCm39) missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146,645,746 (GRCm39) missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146,602,422 (GRCm39) missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146,600,160 (GRCm39) missense probably benign 0.02
R1789:Ttll7 UTSW 3 146,621,535 (GRCm39) missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146,621,550 (GRCm39) splice site probably benign
R1995:Ttll7 UTSW 3 146,667,510 (GRCm39) missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146,635,859 (GRCm39) missense possibly damaging 0.77
R2655:Ttll7 UTSW 3 146,653,376 (GRCm39) missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146,636,170 (GRCm39) nonsense probably null
R4888:Ttll7 UTSW 3 146,599,932 (GRCm39) start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146,600,224 (GRCm39) missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146,667,465 (GRCm39) missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146,649,847 (GRCm39) nonsense probably null
R6009:Ttll7 UTSW 3 146,640,290 (GRCm39) missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146,645,917 (GRCm39) missense probably benign
R6036:Ttll7 UTSW 3 146,645,917 (GRCm39) missense probably benign
R6463:Ttll7 UTSW 3 146,637,337 (GRCm39) missense possibly damaging 0.86
R6747:Ttll7 UTSW 3 146,649,811 (GRCm39) missense probably benign 0.02
R6922:Ttll7 UTSW 3 146,615,369 (GRCm39) missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146,619,051 (GRCm39) missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146,619,031 (GRCm39) missense probably damaging 0.97
R8229:Ttll7 UTSW 3 146,607,204 (GRCm39) missense probably damaging 0.99
R8406:Ttll7 UTSW 3 146,645,779 (GRCm39) missense probably benign
R9343:Ttll7 UTSW 3 146,667,497 (GRCm39) missense probably damaging 1.00
R9348:Ttll7 UTSW 3 146,673,768 (GRCm39) missense probably benign 0.31
R9629:Ttll7 UTSW 3 146,621,487 (GRCm39) missense probably damaging 1.00
RF015:Ttll7 UTSW 3 146,685,413 (GRCm39) missense probably benign 0.00
X0024:Ttll7 UTSW 3 146,615,308 (GRCm39) missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146,667,450 (GRCm39) missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146,653,408 (GRCm39) missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146,653,390 (GRCm39) missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146,635,933 (GRCm39) missense probably benign 0.01
Z1176:Ttll7 UTSW 3 146,621,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGCCATCAGAAGTTTTC -3'
(R):5'- CCTGCTTTCGTACTTGAAGGAG -3'

Sequencing Primer
(F):5'- AGAAGTTTTCTGAAGTGAGAGTTATG -3'
(R):5'- GCTTTCGTACTTGAAGGAGTCTCTC -3'
Posted On 2014-10-01