Mutagenetix > Incidental Mutations

Incidental Mutation 'R2152:Ptpn12'

234368

Institutional Source

Beutler Lab

Gene Symbol

Ptpn12

Ensembl Gene

ENSMUSG00000028771

Gene Name

protein tyrosine phosphatase, non-receptor type 12

Synonyms

P19-PTP, PTP-PEST, PTP-P19

MMRRC Submission

040155-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2152 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20986645-21055911 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21002468 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 297 (Q297H)

Ref Sequence

ENSEMBL: ENSMUSP00000030556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030556] [ENSMUST00000151813] [ENSMUST00000199774]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030556
AA Change: Q297H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: Q297H

Domain	Start	End	E-Value	Type
PTPc	27	295	2.14e-126	SMART
Blast:PTPc	338	399	7e-12	BLAST
low complexity region	499	518	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148711

Predicted Effect

probably benign
Transcript: ENSMUST00000151813

Predicted Effect

probably benign
Transcript: ENSMUST00000199774

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,934	D298V	probably damaging	Het
Ackr3	A	T	1: 90,213,843	Y8F	probably benign	Het
Acy1	T	C	9: 106,435,617	E175G	probably damaging	Het
Add2	T	C	6: 86,098,598	L243P	probably damaging	Het
Adsl	A	G	15: 80,967,662	D407G	probably damaging	Het
Afg3l1	T	G	8: 123,494,836	I478S	probably damaging	Het
Arfrp1	T	C	2: 181,359,694	T108A	probably benign	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Bbs12	G	T	3: 37,321,160	E586*	probably null	Het
Bicd2	G	T	13: 49,379,576	C546F	probably damaging	Het
Bid	A	T	6: 120,900,254	L42Q	probably damaging	Het
Bpifb9a	A	G	2: 154,260,135	K51E	probably benign	Het
Calcr	G	T	6: 3,687,615	T424K	probably benign	Het
Cd46	A	G	1: 195,062,413	I339T	probably benign	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cntn3	A	G	6: 102,206,537	I719T	probably damaging	Het
Cyb5r1	T	C	1: 134,409,625	I163T	possibly damaging	Het
Cyp2d26	A	T	15: 82,792,706		probably null	Het
Dclk1	A	G	3: 55,247,212	Y21C	probably damaging	Het
Dgcr2	G	A	16: 17,891,487		probably null	Het
Dhx38	T	C	8: 109,560,674	S221G	probably benign	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dnah3	C	T	7: 119,952,013	V3028I	probably benign	Het
Dnah6	T	C	6: 73,049,166	Y3448C	probably benign	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Doxl2	T	A	6: 48,976,539	I466N	probably damaging	Het
Epb41l1	A	G	2: 156,514,128	D528G	probably damaging	Het
Fat4	A	T	3: 38,983,395	Y3732F	probably damaging	Het
Fgfr4	A	T	13: 55,166,964	Y640F	probably damaging	Het
Foxo6	T	A	4: 120,268,614	D328V	probably benign	Het
Foxp1	A	G	6: 99,016,541	L134P	probably damaging	Het
Frem2	G	A	3: 53,517,029	R2996*	probably null	Het
Fuk	T	A	8: 110,889,072	T542S	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gcn1l1	T	A	5: 115,609,829	I1765N	probably benign	Het
Gm4787	T	A	12: 81,377,219	I722F	probably benign	Het
Gpc6	G	T	14: 116,926,092	A53S	probably benign	Het
Gtpbp8	A	G	16: 44,740,027		probably null	Het
H2-Q2	T	C	17: 35,345,276		probably null	Het
Hapln2	C	A	3: 88,023,613	R157L	probably benign	Het
Hemgn	C	A	4: 46,396,607	E210*	probably null	Het
Hpse	T	A	5: 100,691,403	K360*	probably null	Het
Iqcj	A	T	3: 68,055,310	E68V	probably damaging	Het
Kat2a	T	C	11: 100,712,346		probably benign	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kcnab1	A	T	3: 65,371,440	I371F	probably damaging	Het
Klhl30	C	A	1: 91,357,824	A356D	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Micu1	G	T	10: 59,863,288	M468I	probably benign	Het
Mrc1	A	G	2: 14,327,864	T1292A	probably damaging	Het
Myh8	G	A	11: 67,294,469	E849K	probably damaging	Het
Myom3	G	T	4: 135,803,233	R1152L	probably benign	Het
Nedd4l	T	A	18: 65,210,330	H820Q	probably damaging	Het
Nlrp4g	T	A	9: 124,353,339		noncoding transcript	Het
Olfr1339	C	T	4: 118,735,249	A240V	possibly damaging	Het
Olfr1413	T	C	1: 92,573,908	S246P	probably damaging	Het
Olfr24	T	C	9: 18,755,095	D180G	probably damaging	Het
Olfr33	G	T	7: 102,713,581	H277Q	probably benign	Het
Olfr435	A	G	6: 43,202,069	I142V	probably benign	Het
Olfr592	A	T	7: 103,186,640	D13V	probably benign	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Olfr969	A	T	9: 39,795,647	I91F	probably benign	Het
Otop1	T	A	5: 38,302,851	M587K	probably damaging	Het
Pgm5	T	A	19: 24,834,815	I118F	probably damaging	Het
Phc2	A	G	4: 128,745,066	*41W	probably null	Het
Piezo2	A	T	18: 63,114,041	M532K	probably damaging	Het
Pjvk	A	T	2: 76,658,369	I295F	probably benign	Het
Popdc2	A	G	16: 38,363,120	N155S	possibly damaging	Het
Ppp4r3a	G	T	12: 101,042,567	N684K	probably damaging	Het
Prpf4b	T	A	13: 34,900,419	M930K	probably benign	Het
Ptprz1	C	A	6: 23,030,671	L1010I	probably damaging	Het
Rabepk	A	T	2: 34,784,550	D232E	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Rb1	T	C	14: 73,288,725	T169A	probably benign	Het
Rcc2	T	C	4: 140,717,117	L373P	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rrbp1	A	G	2: 143,954,198	L1200P	possibly damaging	Het
Sdk1	A	G	5: 141,792,944	N226D	probably damaging	Het
Selenbp1	G	A	3: 94,944,130	R398H	probably damaging	Het
Selenoo	A	G	15: 89,099,282	M509V	probably benign	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc2a5	T	G	4: 150,125,638	S27A	probably damaging	Het
Slc30a5	A	T	13: 100,803,949	H619Q	probably damaging	Het
Slc5a9	A	G	4: 111,893,223	I146T	possibly damaging	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Snx29	A	G	16: 11,400,843	D181G	possibly damaging	Het
Spata31d1c	G	A	13: 65,033,965		probably null	Het
Stat5a	C	A	11: 100,874,090	T213N	probably benign	Het
Stt3a	A	T	9: 36,747,996	V349D	probably damaging	Het
Tcf20	A	T	15: 82,855,602	D549E	probably damaging	Het
Thbs2	T	A	17: 14,673,209	D903V	probably damaging	Het
Tln2	T	C	9: 67,302,560	T432A	probably damaging	Het
Tmc1	A	T	19: 20,856,675	N241K	probably benign	Het
Tmem260	G	T	14: 48,477,609	R240L	possibly damaging	Het
Tnfaip6	A	T	2: 52,043,730	E32D	probably damaging	Het
Trpa1	A	T	1: 14,899,401	H381Q	probably damaging	Het
Tsen2	T	C	6: 115,547,975	I45T	possibly damaging	Het
Ttc6	G	A	12: 57,705,552	V1415I	probably damaging	Het
Ttll7	G	T	3: 146,930,189	R426L	probably damaging	Het
Ttn	A	C	2: 76,740,138	S26804A	probably damaging	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn2r73	A	G	7: 85,857,728	V792A	probably benign	Het
Zfp345	T	C	2: 150,472,658	T320A	probably benign	Het
Zfp407	T	C	18: 84,209,649	D1945G	possibly damaging	Het

Other mutations in Ptpn12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Ptpn12	APN	5	21029850	missense	probably damaging	1.00
IGL00226:Ptpn12	APN	5	20998668	missense	probably damaging	1.00
IGL01432:Ptpn12	APN	5	20998555	nonsense	probably null
IGL02285:Ptpn12	APN	5	21055713	missense	probably benign	0.40
IGL02488:Ptpn12	APN	5	21022062	missense	possibly damaging	0.72
IGL02550:Ptpn12	APN	5	20998139	missense	probably benign	0.00
IGL02640:Ptpn12	APN	5	21019246	missense	probably damaging	1.00
IGL02652:Ptpn12	APN	5	21002437	missense	probably benign	0.04
IGL03130:Ptpn12	APN	5	21002612	unclassified	probably benign
R0531:Ptpn12	UTSW	5	20998483	missense	possibly damaging	0.53
R0948:Ptpn12	UTSW	5	20998043	missense	probably benign
R1018:Ptpn12	UTSW	5	21029869	missense	possibly damaging	0.94
R1184:Ptpn12	UTSW	5	20998356	missense	possibly damaging	0.86
R1699:Ptpn12	UTSW	5	20998170	missense	probably benign	0.01
R1938:Ptpn12	UTSW	5	20993263	missense	probably damaging	1.00
R1952:Ptpn12	UTSW	5	20998310	missense	probably benign	0.34
R2153:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2154:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2267:Ptpn12	UTSW	5	20998411	missense	probably damaging	0.98
R2358:Ptpn12	UTSW	5	20998692	missense	probably damaging	1.00
R3551:Ptpn12	UTSW	5	20989049	missense	possibly damaging	0.67
R3931:Ptpn12	UTSW	5	21001323	missense	probably benign	0.00
R4013:Ptpn12	UTSW	5	20992743	missense	probably benign	0.05
R4039:Ptpn12	UTSW	5	21002510	nonsense	probably null
R4501:Ptpn12	UTSW	5	21019280	missense	probably damaging	1.00
R4748:Ptpn12	UTSW	5	21005385	nonsense	probably null
R4754:Ptpn12	UTSW	5	20998589	missense	probably benign	0.34
R4963:Ptpn12	UTSW	5	21015708	splice site	probably null
R5160:Ptpn12	UTSW	5	20997831	missense	probably damaging	1.00
R5581:Ptpn12	UTSW	5	21015726	missense	probably damaging	1.00
R5789:Ptpn12	UTSW	5	20989015	missense	possibly damaging	0.92
R5836:Ptpn12	UTSW	5	21009546	nonsense	probably null
R6383:Ptpn12	UTSW	5	20987468	nonsense	probably null
R6883:Ptpn12	UTSW	5	21055713	missense	probably benign	0.40
R7544:Ptpn12	UTSW	5	21009511	missense	probably damaging	1.00
R7885:Ptpn12	UTSW	5	20998525	missense	possibly damaging	0.54
R7915:Ptpn12	UTSW	5	21009451	missense	probably damaging	1.00
R7960:Ptpn12	UTSW	5	21055689	missense	probably benign	0.01
R7976:Ptpn12	UTSW	5	21002633	nonsense	probably null
R8032:Ptpn12	UTSW	5	20998043	missense	probably benign
R8224:Ptpn12	UTSW	5	20998658	missense	probably damaging	1.00
R8473:Ptpn12	UTSW	5	20998359	missense	probably benign	0.00
X0004:Ptpn12	UTSW	5	21019296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTTAGTGACCCACATCAG -3'
(R):5'- CTCGGCAGTACAAACAAAGG -3'

Sequencing Primer
(F):5'- GGCTATACAGAGAAACCCTGTCTTG -3'
(R):5'- ACAAAGGTAGAGTTGGTTTTTCTC -3'

Posted On

2014-10-01