Mutagenetix > Incidental Mutations

Incidental Mutation 'R2152:Tln2'

234408

Institutional Source

Beutler Lab

Gene Symbol

Tln2

Ensembl Gene

ENSMUSG00000052698

Gene Name

talin 2

Synonyms

MMRRC Submission

040155-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R2152 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67217087-67559703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67302560 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 432 (T432A)

Ref Sequence

ENSEMBL: ENSMUSP00000149474 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215267] [ENSMUST00000215784] [ENSMUST00000217550]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039662
AA Change: T1518A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: T1518A

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	3.4e-59	PFAM
Pfam:I_LWEQ	661	765	1.9e-10	PFAM
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	2.6e-67	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2384	2531	2.5e-52	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040025
AA Change: T1518A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: T1518A

Domain	Start	End	E-Value	Type
B41	84	316	1.29e-66	SMART
IRS	311	404	6.31e-17	SMART
Pfam:Talin_middle	494	655	8.5e-78	PFAM
low complexity region	674	693	N/A	INTRINSIC
internal_repeat_2	703	763	2.05e-7	PROSPERO
low complexity region	770	778	N/A	INTRINSIC
PDB:2L7A\|A	797	901	3e-44	PDB
low complexity region	902	918	N/A	INTRINSIC
low complexity region	923	946	N/A	INTRINSIC
internal_repeat_4	973	1033	7.18e-6	PROSPERO
internal_repeat_3	1083	1210	3.53e-6	PROSPERO
internal_repeat_4	1138	1198	7.18e-6	PROSPERO
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1330	1343	N/A	INTRINSIC
internal_repeat_1	1482	1554	2.88e-9	PROSPERO
internal_repeat_2	1491	1551	2.05e-7	PROSPERO
low complexity region	1679	1690	N/A	INTRINSIC
Pfam:VBS	1850	1974	9.9e-72	PFAM
internal_repeat_3	2010	2138	3.53e-6	PROSPERO
low complexity region	2309	2325	N/A	INTRINSIC
low complexity region	2349	2359	N/A	INTRINSIC
Pfam:I_LWEQ	2383	2533	4.3e-51	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215267
AA Change: T428A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215784
AA Change: T1520A

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217550
AA Change: T432A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	A	17: 33,066,934	D298V	probably damaging	Het
Ackr3	A	T	1: 90,213,843	Y8F	probably benign	Het
Acy1	T	C	9: 106,435,617	E175G	probably damaging	Het
Add2	T	C	6: 86,098,598	L243P	probably damaging	Het
Adsl	A	G	15: 80,967,662	D407G	probably damaging	Het
Afg3l1	T	G	8: 123,494,836	I478S	probably damaging	Het
Arfrp1	T	C	2: 181,359,694	T108A	probably benign	Het
Art5	A	G	7: 102,098,200	L124P	possibly damaging	Het
Asap2	A	T	12: 21,112,083	T14S	probably damaging	Het
Atp2c2	A	G	8: 119,756,102	N901S	probably benign	Het
Bbs12	G	T	3: 37,321,160	E586*	probably null	Het
Bicd2	G	T	13: 49,379,576	C546F	probably damaging	Het
Bid	A	T	6: 120,900,254	L42Q	probably damaging	Het
Bpifb9a	A	G	2: 154,260,135	K51E	probably benign	Het
Calcr	G	T	6: 3,687,615	T424K	probably benign	Het
Cd46	A	G	1: 195,062,413	I339T	probably benign	Het
Chek1	C	A	9: 36,723,983	V35F	probably damaging	Het
Cntn3	A	G	6: 102,206,537	I719T	probably damaging	Het
Cyb5r1	T	C	1: 134,409,625	I163T	possibly damaging	Het
Cyp2d26	A	T	15: 82,792,706		probably null	Het
Dclk1	A	G	3: 55,247,212	Y21C	probably damaging	Het
Dgcr2	G	A	16: 17,891,487		probably null	Het
Dhx38	T	C	8: 109,560,674	S221G	probably benign	Het
Dis3l	T	A	9: 64,307,263	N981I	probably benign	Het
Dnah3	C	T	7: 119,952,013	V3028I	probably benign	Het
Dnah6	T	C	6: 73,049,166	Y3448C	probably benign	Het
Dok5	G	A	2: 170,800,896	G38D	probably damaging	Het
Doxl2	T	A	6: 48,976,539	I466N	probably damaging	Het
Epb41l1	A	G	2: 156,514,128	D528G	probably damaging	Het
Fat4	A	T	3: 38,983,395	Y3732F	probably damaging	Het
Fgfr4	A	T	13: 55,166,964	Y640F	probably damaging	Het
Foxo6	T	A	4: 120,268,614	D328V	probably benign	Het
Foxp1	A	G	6: 99,016,541	L134P	probably damaging	Het
Frem2	G	A	3: 53,517,029	R2996*	probably null	Het
Fuk	T	A	8: 110,889,072	T542S	probably benign	Het
Garem2	T	C	5: 30,108,299	S54P	probably damaging	Het
Gcn1l1	T	A	5: 115,609,829	I1765N	probably benign	Het
Gm4787	T	A	12: 81,377,219	I722F	probably benign	Het
Gpc6	G	T	14: 116,926,092	A53S	probably benign	Het
Gtpbp8	A	G	16: 44,740,027		probably null	Het
H2-Q2	T	C	17: 35,345,276		probably null	Het
Hapln2	C	A	3: 88,023,613	R157L	probably benign	Het
Hemgn	C	A	4: 46,396,607	E210*	probably null	Het
Hpse	T	A	5: 100,691,403	K360*	probably null	Het
Iqcj	A	T	3: 68,055,310	E68V	probably damaging	Het
Kat2a	T	C	11: 100,712,346		probably benign	Het
Kat6b	A	T	14: 21,668,667	H1138L	probably benign	Het
Kcnab1	A	T	3: 65,371,440	I371F	probably damaging	Het
Klhl30	C	A	1: 91,357,824	A356D	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Micu1	G	T	10: 59,863,288	M468I	probably benign	Het
Mrc1	A	G	2: 14,327,864	T1292A	probably damaging	Het
Myh8	G	A	11: 67,294,469	E849K	probably damaging	Het
Myom3	G	T	4: 135,803,233	R1152L	probably benign	Het
Nedd4l	T	A	18: 65,210,330	H820Q	probably damaging	Het
Nlrp4g	T	A	9: 124,353,339		noncoding transcript	Het
Olfr1339	C	T	4: 118,735,249	A240V	possibly damaging	Het
Olfr1413	T	C	1: 92,573,908	S246P	probably damaging	Het
Olfr24	T	C	9: 18,755,095	D180G	probably damaging	Het
Olfr33	G	T	7: 102,713,581	H277Q	probably benign	Het
Olfr435	A	G	6: 43,202,069	I142V	probably benign	Het
Olfr592	A	T	7: 103,186,640	D13V	probably benign	Het
Olfr913	G	T	9: 38,594,411	L63F	probably damaging	Het
Olfr969	A	T	9: 39,795,647	I91F	probably benign	Het
Otop1	T	A	5: 38,302,851	M587K	probably damaging	Het
Pgm5	T	A	19: 24,834,815	I118F	probably damaging	Het
Phc2	A	G	4: 128,745,066	*41W	probably null	Het
Piezo2	A	T	18: 63,114,041	M532K	probably damaging	Het
Pjvk	A	T	2: 76,658,369	I295F	probably benign	Het
Popdc2	A	G	16: 38,363,120	N155S	possibly damaging	Het
Ppp4r3a	G	T	12: 101,042,567	N684K	probably damaging	Het
Prpf4b	T	A	13: 34,900,419	M930K	probably benign	Het
Ptpn12	C	A	5: 21,002,468	Q297H	probably damaging	Het
Ptprz1	C	A	6: 23,030,671	L1010I	probably damaging	Het
Rabepk	A	T	2: 34,784,550	D232E	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,985	H636R	probably benign	Het
Rb1	T	C	14: 73,288,725	T169A	probably benign	Het
Rcc2	T	C	4: 140,717,117	L373P	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rrbp1	A	G	2: 143,954,198	L1200P	possibly damaging	Het
Sdk1	A	G	5: 141,792,944	N226D	probably damaging	Het
Selenbp1	G	A	3: 94,944,130	R398H	probably damaging	Het
Selenoo	A	G	15: 89,099,282	M509V	probably benign	Het
Sidt2	T	C	9: 45,945,340	D477G	probably damaging	Het
Slc2a5	T	G	4: 150,125,638	S27A	probably damaging	Het
Slc30a5	A	T	13: 100,803,949	H619Q	probably damaging	Het
Slc5a9	A	G	4: 111,893,223	I146T	possibly damaging	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slmap	A	G	14: 26,418,247	Y771H	probably damaging	Het
Snx29	A	G	16: 11,400,843	D181G	possibly damaging	Het
Spata31d1c	G	A	13: 65,033,965		probably null	Het
Stat5a	C	A	11: 100,874,090	T213N	probably benign	Het
Stt3a	A	T	9: 36,747,996	V349D	probably damaging	Het
Tcf20	A	T	15: 82,855,602	D549E	probably damaging	Het
Thbs2	T	A	17: 14,673,209	D903V	probably damaging	Het
Tmc1	A	T	19: 20,856,675	N241K	probably benign	Het
Tmem260	G	T	14: 48,477,609	R240L	possibly damaging	Het
Tnfaip6	A	T	2: 52,043,730	E32D	probably damaging	Het
Trpa1	A	T	1: 14,899,401	H381Q	probably damaging	Het
Tsen2	T	C	6: 115,547,975	I45T	possibly damaging	Het
Ttc6	G	A	12: 57,705,552	V1415I	probably damaging	Het
Ttll7	G	T	3: 146,930,189	R426L	probably damaging	Het
Ttn	A	C	2: 76,740,138	S26804A	probably damaging	Het
Ubqlnl	A	T	7: 104,148,683	C536S	probably benign	Het
Vmn2r73	A	G	7: 85,857,728	V792A	probably benign	Het
Zfp345	T	C	2: 150,472,658	T320A	probably benign	Het
Zfp407	T	C	18: 84,209,649	D1945G	possibly damaging	Het

Other mutations in Tln2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Tln2	APN	9	67344187	missense	possibly damaging	0.59
IGL01110:Tln2	APN	9	67250582	nonsense	probably null
IGL01112:Tln2	APN	9	67311811	missense	probably damaging	1.00
IGL01307:Tln2	APN	9	67395467	missense	probably benign	0.25
IGL01374:Tln2	APN	9	67261923	missense	probably damaging	1.00
IGL01625:Tln2	APN	9	67370623	missense	probably damaging	1.00
IGL01865:Tln2	APN	9	67250614	nonsense	probably null
IGL01999:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02002:Tln2	APN	9	67356698	missense	probably damaging	0.98
IGL02005:Tln2	APN	9	67392505	missense	possibly damaging	0.81
IGL02015:Tln2	APN	9	67361439	splice site	probably benign
IGL02368:Tln2	APN	9	67240810	splice site	probably benign
IGL02444:Tln2	APN	9	67258592	splice site	probably benign
IGL02646:Tln2	APN	9	67255996	missense	probably benign	0.43
IGL02744:Tln2	APN	9	67229376	nonsense	probably null
IGL02869:Tln2	APN	9	67221525	splice site	probably benign
IGL02930:Tln2	APN	9	67393662	nonsense	probably null
IGL03100:Tln2	APN	9	67295737	missense	probably damaging	1.00
IGL03326:Tln2	APN	9	67334257	missense	possibly damaging	0.67
BB008:Tln2	UTSW	9	67258460	critical splice donor site	probably null
BB018:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0047:Tln2	UTSW	9	67240672	splice site	probably benign
R0107:Tln2	UTSW	9	67370706	missense	probably damaging	1.00
R0494:Tln2	UTSW	9	67355197	missense	probably benign	0.22
R0884:Tln2	UTSW	9	67370733	missense	probably damaging	1.00
R0947:Tln2	UTSW	9	67295813	missense	probably benign	0.08
R0989:Tln2	UTSW	9	67229454	missense	probably damaging	1.00
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1195:Tln2	UTSW	9	67258566	missense	probably damaging	0.96
R1486:Tln2	UTSW	9	67311839	missense	probably damaging	1.00
R1527:Tln2	UTSW	9	67272668	missense	possibly damaging	0.95
R1584:Tln2	UTSW	9	67296414	missense	probably damaging	1.00
R1636:Tln2	UTSW	9	67306532	missense	probably damaging	1.00
R1656:Tln2	UTSW	9	67227107	missense	possibly damaging	0.81
R1707:Tln2	UTSW	9	67375807	missense	probably benign	0.00
R1749:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1751:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1761:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1767:Tln2	UTSW	9	67286514	missense	probably benign	0.01
R1815:Tln2	UTSW	9	67229423	missense	probably damaging	1.00
R1840:Tln2	UTSW	9	67342043	missense	probably damaging	1.00
R1847:Tln2	UTSW	9	67362687	nonsense	probably null
R1964:Tln2	UTSW	9	67342135	missense	probably benign	0.00
R1968:Tln2	UTSW	9	67255901	missense	probably damaging	1.00
R2036:Tln2	UTSW	9	67272704	missense	possibly damaging	0.76
R2038:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R2153:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2154:Tln2	UTSW	9	67302560	missense	probably damaging	1.00
R2191:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2192:Tln2	UTSW	9	67355221	missense	probably damaging	1.00
R2201:Tln2	UTSW	9	67375757	missense	probably damaging	1.00
R3116:Tln2	UTSW	9	67355139	missense	probably benign	0.10
R3151:Tln2	UTSW	9	67330547	critical splice donor site	probably null
R3795:Tln2	UTSW	9	67255915	missense	probably damaging	0.97
R3953:Tln2	UTSW	9	67370629	missense	probably damaging	1.00
R4450:Tln2	UTSW	9	67344065	critical splice donor site	probably null
R4685:Tln2	UTSW	9	67302572	missense	probably damaging	1.00
R4688:Tln2	UTSW	9	67397653	start codon destroyed	probably benign	0.01
R4696:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4697:Tln2	UTSW	9	67395461	missense	probably damaging	1.00
R4700:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4701:Tln2	UTSW	9	67346527	missense	probably benign	0.03
R4741:Tln2	UTSW	9	67386555	critical splice donor site	probably null
R4806:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4807:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4808:Tln2	UTSW	9	67331733	missense	probably benign	0.29
R4967:Tln2	UTSW	9	67355125	missense	probably damaging	0.97
R5061:Tln2	UTSW	9	67354468	missense	probably benign
R5092:Tln2	UTSW	9	67256028	missense	probably benign	0.13
R5093:Tln2	UTSW	9	67334314	missense	probably benign	0.44
R5126:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R5204:Tln2	UTSW	9	67354482	missense	probably benign	0.00
R5236:Tln2	UTSW	9	67365923	missense	probably damaging	0.99
R5287:Tln2	UTSW	9	67242359	missense	probably damaging	1.00
R5568:Tln2	UTSW	9	67311865	missense	probably damaging	1.00
R5571:Tln2	UTSW	9	67334320	missense	possibly damaging	0.88
R5642:Tln2	UTSW	9	67296358	missense	probably benign	0.01
R5711:Tln2	UTSW	9	67392547	missense	probably benign	0.00
R5776:Tln2	UTSW	9	67258250	missense	probably damaging	1.00
R5791:Tln2	UTSW	9	67386605	missense	probably damaging	0.98
R5866:Tln2	UTSW	9	67266868	missense	probably damaging	1.00
R5888:Tln2	UTSW	9	67229403	missense	probably damaging	1.00
R5902:Tln2	UTSW	9	67362717	missense	probably benign	0.02
R6106:Tln2	UTSW	9	67323020	missense	probably damaging	0.99
R6175:Tln2	UTSW	9	67224081	missense	probably damaging	1.00
R6385:Tln2	UTSW	9	67278129	missense	probably benign	0.45
R6430:Tln2	UTSW	9	67272665	missense	probably damaging	1.00
R6441:Tln2	UTSW	9	67272689	missense	probably damaging	1.00
R6738:Tln2	UTSW	9	67386664	missense	possibly damaging	0.91
R6776:Tln2	UTSW	9	67262905	missense	probably damaging	1.00
R6794:Tln2	UTSW	9	67286558	missense	probably benign	0.07
R6850:Tln2	UTSW	9	67258535	missense	probably damaging	1.00
R6907:Tln2	UTSW	9	67397635	missense	probably damaging	0.98
R6909:Tln2	UTSW	9	67392532	missense	probably damaging	0.97
R6951:Tln2	UTSW	9	67258485	missense	probably damaging	0.97
R7015:Tln2	UTSW	9	67362647	missense	possibly damaging	0.55
R7051:Tln2	UTSW	9	67346417	missense	probably benign	0.00
R7246:Tln2	UTSW	9	67262979	missense	probably damaging	1.00
R7292:Tln2	UTSW	9	67346461	missense	probably benign
R7753:Tln2	UTSW	9	67395473	missense	probably damaging	1.00
R7868:Tln2	UTSW	9	67348226	missense	probably damaging	1.00
R7931:Tln2	UTSW	9	67258460	critical splice donor site	probably null
R8023:Tln2	UTSW	9	67224064	missense	probably damaging	1.00
R8081:Tln2	UTSW	9	67356747	missense	probably damaging	1.00
R8164:Tln2	UTSW	9	67319420	missense	probably benign	0.31
R8192:Tln2	UTSW	9	67346529	nonsense	probably null
R8495:Tln2	UTSW	9	67354467	missense	probably benign	0.01
X0027:Tln2	UTSW	9	67376853	missense	probably damaging	1.00
X0064:Tln2	UTSW	9	67348138	missense	probably damaging	1.00
X0067:Tln2	UTSW	9	67370691	missense	probably damaging	1.00
Z1176:Tln2	UTSW	9	67346485	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GTAAGTGGAAGCAACCCCTC -3'
(R):5'- AAACAAGACTGCCCAGATTCTG -3'

Sequencing Primer
(F):5'- TCACCTATGACTTAAGGGCTACC -3'
(R):5'- CAGATTCTGGACATGTGGGC -3'

Posted On

2014-10-01