Mutagenetix > Incidental Mutations

Incidental Mutation 'R0196:Cep295'

23441

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

038455-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R0196 (G1)

Quality Score

182

Status

Not validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15338213 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 469 (S469T)

Ref Sequence

ENSEMBL: ENSMUSP00000096578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000058041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066038

Predicted Effect

probably damaging
Transcript: ENSMUST00000098979
AA Change: S469T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: S469T

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160946

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: S469T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: S469T

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161795
AA Change: S421T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: S421T

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 81.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933409G03Rik	A	G	2: 68,616,247		probably benign	Het
Aass	G	A	6: 23,109,520	P317L	probably damaging	Het
Abca12	T	A	1: 71,259,813	N2313I	possibly damaging	Het
Adamts12	T	C	15: 11,071,508	I46T	probably benign	Het
Adipoq	T	G	16: 23,146,643		probably null	Het
Amy1	A	T	3: 113,569,421	D92E	probably benign	Het
Asb15	G	A	6: 24,564,393	R282Q	probably damaging	Het
Bag6	G	C	17: 35,144,263	G693A	probably damaging	Het
Birc6	T	C	17: 74,580,287	I870T	possibly damaging	Het
Cand2	A	G	6: 115,789,502	K356R	probably damaging	Het
Cbfa2t3	T	C	8: 122,633,337	Q525R	possibly damaging	Het
Ccdc94	C	A	17: 55,964,653	D191E	probably damaging	Het
Cd4	T	C	6: 124,867,806	R339G	probably damaging	Het
Cdh8	A	G	8: 99,190,434	S350P	probably damaging	Het
Ckap2l	A	T	2: 129,285,422	S279T	probably benign	Het
Clnk	T	A	5: 38,769,939	N66Y	probably damaging	Het
Col27a1	A	T	4: 63,224,266	T64S	probably benign	Het
Crtc1	T	C	8: 70,386,221	D599G	probably damaging	Het
Cyp2c23	A	C	19: 44,012,356	I363S	probably damaging	Het
Dnah10	A	T	5: 124,834,075	I4519F	possibly damaging	Het
Dner	T	A	1: 84,370,832	I716F	probably damaging	Het
Dsel	T	G	1: 111,861,603	T401P	possibly damaging	Het
Egfr	A	G	11: 16,911,746	D1175G	probably benign	Het
Ephb3	A	T	16: 21,218,054	N343I	probably damaging	Het
Fbxw10	T	A	11: 62,877,244	F974I	probably benign	Het
Gfi1b	T	C	2: 28,613,774	Y138C	probably damaging	Het
Gm11168	T	A	9: 3,005,175	L6H	probably benign	Het
Grb10	A	C	11: 11,945,583	V247G	probably damaging	Het
Gstp2	A	T	19: 4,040,514		probably null	Het
Hars2	C	T	18: 36,789,204	Q291*	probably null	Het
Hyal4	G	T	6: 24,756,221	W146L	probably damaging	Het
Il22ra1	C	T	4: 135,734,245	T107I	possibly damaging	Het
Itga8	A	G	2: 12,204,729		probably null	Het
Klhl25	T	C	7: 75,865,702	S119P	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lrrc8c	T	C	5: 105,606,770	V137A	probably benign	Het
Macrod2	A	T	2: 142,176,625	E226V	probably damaging	Het
Mcemp1	A	T	8: 3,668,201	Q165L	probably benign	Het
Mcpt9	T	A	14: 56,027,996	K82M	probably benign	Het
Mpzl3	A	G	9: 45,062,160	T66A	probably damaging	Het
Msh6	G	A	17: 87,980,360	V143I	possibly damaging	Het
Mug1	G	A	6: 121,838,725		probably null	Het
Ncr1	G	T	7: 4,340,973	C153F	probably damaging	Het
Nf1	T	A	11: 79,468,769	M1411K	possibly damaging	Het
Nf1	T	A	11: 79,578,272	V786D	probably damaging	Het
Nisch	T	C	14: 31,203,394		probably benign	Het
Nwd2	T	A	5: 63,806,351	Y1093N	probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1352	C	T	10: 78,984,189	T133I	possibly damaging	Het
Olfr392	A	T	11: 73,814,905	M59K	probably damaging	Het
Oxa1l	T	C	14: 54,363,487	I139T	probably damaging	Het
P3h3	T	A	6: 124,845,272	N583Y	probably damaging	Het
Pcdh18	A	T	3: 49,756,698		probably null	Het
Pcnp	C	T	16: 56,024,533		probably benign	Het
Pdzd8	G	T	19: 59,301,131	D612E	probably benign	Het
Pi4kb	T	C	3: 94,998,950	S8P	probably damaging	Het
Pikfyve	T	G	1: 65,256,072	V1454G	possibly damaging	Het
Podn	T	C	4: 108,021,498	N246D	probably damaging	Het
Prg4	T	C	1: 150,454,492		probably benign	Het
R3hdm2	T	C	10: 127,484,521	Y523H	probably damaging	Het
Rpf1	T	A	3: 146,508,149	E231V	possibly damaging	Het
Slc16a10	C	T	10: 40,056,615	E317K	probably benign	Het
Slc34a1	A	T	13: 55,412,265	I435F	probably damaging	Het
Snx19	A	G	9: 30,433,387	D629G	probably damaging	Het
Tomm70a	T	C	16: 57,146,100	I472T	probably benign	Het
Trp53	A	G	11: 69,588,680	Y202C	probably damaging	Het
Ttc14	T	A	3: 33,809,254		probably benign	Het
Ugt1a1	C	T	1: 88,212,555	A185V	possibly damaging	Het
Usp28	A	G	9: 49,028,278	D655G	probably damaging	Het
Vmn1r215	C	T	13: 23,076,084	T98I	probably damaging	Het
Vmn2r121	G	T	X: 124,132,182	T426N	probably benign	Het
Vmn2r99	A	G	17: 19,394,573	N852D	probably benign	Het
Xrn2	T	A	2: 147,047,660	D654E	probably damaging	Het
Zfp335	C	G	2: 164,896,145	A849P	possibly damaging	Het
Zfp954	C	T	7: 7,115,391	V385M	probably damaging	Het
Zmynd15	A	G	11: 70,464,226	T350A	probably damaging	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- AACCATTGAGCCGTTCCTCCAGTC -3'
(R):5'- TGCCCTTGGCAGCAAAGATCCAAC -3'

Sequencing Primer
(F):5'- GTTTTCTCATACATGAGTCAACTACC -3'
(R):5'- TTGGCAGCAAAGATCCAACAAATC -3'

Posted On

2013-04-16