Incidental Mutation 'R0196:Cep295'
ID 23441
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Name centrosomal protein 295
Synonyms LOC382128, 5830418K08Rik
MMRRC Submission 038455-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R0196 (G1)
Quality Score 182
Status Not validated
Chromosome 9
Chromosomal Location 15316915-15357788 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15338213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 469 (S469T)
Ref Sequence ENSEMBL: ENSMUSP00000096578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066038
Predicted Effect probably damaging
Transcript: ENSMUST00000098979
AA Change: S469T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: S469T

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160946
SMART Domains Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111

DomainStartEndE-ValueType
coiled coil region 92 119 N/A INTRINSIC
low complexity region 282 293 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
coiled coil region 451 480 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161132
AA Change: S469T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: S469T

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161795
AA Change: S421T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: S421T

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
internal_repeat_1 842 1056 7.14e-5 PROSPERO
internal_repeat_1 1229 1441 7.14e-5 PROSPERO
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 1955 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 splice site probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 splice site probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
R7697:Cep295 UTSW 9 15354710 missense probably benign 0.01
R7963:Cep295 UTSW 9 15333441 missense possibly damaging 0.90
R8055:Cep295 UTSW 9 15333609 missense probably benign 0.00
R8069:Cep295 UTSW 9 15322586 missense possibly damaging 0.94
R8092:Cep295 UTSW 9 15332982 missense probably benign 0.17
R8117:Cep295 UTSW 9 15334364 missense probably damaging 0.99
R8140:Cep295 UTSW 9 15341533 missense probably benign 0.00
R8178:Cep295 UTSW 9 15333540 missense
R8323:Cep295 UTSW 9 15338233 missense possibly damaging 0.53
R8323:Cep295 UTSW 9 15353061 missense probably damaging 0.96
R8339:Cep295 UTSW 9 15325550 missense
R8351:Cep295 UTSW 9 15322906 missense probably damaging 0.99
R8367:Cep295 UTSW 9 15334530 missense probably benign 0.09
R8725:Cep295 UTSW 9 15332419 nonsense probably null
R8919:Cep295 UTSW 9 15326711 missense probably damaging 1.00
R9015:Cep295 UTSW 9 15332968 missense probably benign 0.00
R9054:Cep295 UTSW 9 15324255 missense possibly damaging 0.92
R9088:Cep295 UTSW 9 15322519 missense probably benign 0.09
R9159:Cep295 UTSW 9 15341608 missense probably benign 0.05
R9243:Cep295 UTSW 9 15332309 missense probably benign 0.36
R9408:Cep295 UTSW 9 15333323 missense probably benign 0.00
R9424:Cep295 UTSW 9 15333203 missense probably damaging 0.98
R9455:Cep295 UTSW 9 15333750 missense possibly damaging 0.90
R9607:Cep295 UTSW 9 15322713 missense probably damaging 0.98
R9648:Cep295 UTSW 9 15323607 missense probably benign 0.00
R9659:Cep295 UTSW 9 15322550 missense probably benign 0.19
R9731:Cep295 UTSW 9 15333966 missense possibly damaging 0.94
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Z1176:Cep295 UTSW 9 15357697 missense probably damaging 0.99
Z1177:Cep295 UTSW 9 15330817 missense
Predicted Primers PCR Primer
(F):5'- AACCATTGAGCCGTTCCTCCAGTC -3'
(R):5'- TGCCCTTGGCAGCAAAGATCCAAC -3'

Sequencing Primer
(F):5'- GTTTTCTCATACATGAGTCAACTACC -3'
(R):5'- TTGGCAGCAAAGATCCAACAAATC -3'
Posted On 2013-04-16