Incidental Mutation 'R2152:Myh8'
ID234415
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R2152 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67294469 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 849 (E849K)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably damaging
Transcript: ENSMUST00000019625
AA Change: E849K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: E849K

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Adsl A G 15: 80,967,662 D407G probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fgfr4 A T 13: 55,166,964 Y640F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Ppp4r3a G T 12: 101,042,567 N684K probably damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Ptprz1 C A 6: 23,030,671 L1010I probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7498:Myh8 UTSW 11 67283437 missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67298652 missense possibly damaging 0.51
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATTGTCAGGATGAACACGC -3'
(R):5'- GGTGCTATGACATGGTCAGG -3'

Sequencing Primer
(F):5'- GGAAAACCATGTTGCCTGC -3'
(R):5'- GATAGAGCACTTACAGATTGAACCTG -3'
Posted On2014-10-01